ID: 987083675

View in Genome Browser
Species Human (GRCh38)
Location 5:14448835-14448857
Sequence TTACCAGTGATTACTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987083675_987083685 25 Left 987083675 5:14448835-14448857 CCCCTCCCAGTAATCACTGGTAA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 987083685 5:14448883-14448905 TTTGTTATAGCTTAGACTTTTGG 0: 1
1: 0
2: 1
3: 18
4: 304
987083675_987083682 -8 Left 987083675 5:14448835-14448857 CCCCTCCCAGTAATCACTGGTAA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 987083682 5:14448850-14448872 ACTGGTAAGATAGTTCCTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 533
987083675_987083680 -10 Left 987083675 5:14448835-14448857 CCCCTCCCAGTAATCACTGGTAA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 987083680 5:14448848-14448870 TCACTGGTAAGATAGTTCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 95
987083675_987083681 -9 Left 987083675 5:14448835-14448857 CCCCTCCCAGTAATCACTGGTAA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 987083681 5:14448849-14448871 CACTGGTAAGATAGTTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987083675 Original CRISPR TTACCAGTGATTACTGGGAG GGG (reversed) Intronic
902077370 1:13798550-13798572 GTACCAGTGTAGACTGGGAGGGG - Intronic
905291151 1:36922577-36922599 TTACCAGGAATCACTGGGATTGG + Intronic
906536790 1:46555187-46555209 TCACCAGTGAATAGTGGCAGAGG + Intergenic
909863617 1:80637999-80638021 TTACCAGTTTGCACTGGGAGAGG - Intergenic
911133184 1:94411976-94411998 TTGCCAGGGACTACGGGGAGAGG + Intergenic
913448795 1:118978003-118978025 TTTCCAGTTATTTCTGGGAATGG + Intronic
917290282 1:173465272-173465294 CTTCCAGTGTTGACTGGGAGTGG - Intergenic
917679565 1:177352201-177352223 TTACCACAGATTACTGGGGAGGG + Intergenic
918769131 1:188530894-188530916 TTACTAGTAATTATTTGGAGAGG + Intergenic
918878635 1:190084493-190084515 TTACCAGTTTGCACTGGGAGAGG - Intergenic
920906154 1:210171540-210171562 TCAGCAGTGAGTACTGGGAAAGG - Intergenic
921249570 1:213283713-213283735 TTAGGAGAGATTGCTGGGAGTGG + Intergenic
1065045927 10:21747631-21747653 TTACCAGTGATGCCTGGGAAAGG - Intergenic
1075375656 10:121975834-121975856 TTCTCAGTGATTTCTGTGAGGGG - Intergenic
1075834396 10:125441309-125441331 TTACCAGAGACTAGGGGGAGGGG + Intergenic
1076188920 10:128469409-128469431 TGGTCAGTGCTTACTGGGAGAGG - Intergenic
1078440125 11:11357732-11357754 TTTCCTGTGATTCTTGGGAGGGG + Intronic
1079616847 11:22505500-22505522 TTCTCAGTTATAACTGGGAGCGG - Intergenic
1079711273 11:23685381-23685403 TTGCCAGTGTTTCCTGGGACTGG + Intergenic
1081058034 11:38434993-38435015 TTTCTAATAATTACTGGGAGAGG + Intergenic
1082220717 11:49632348-49632370 TTCCCAGTGATTTTTGGGGGAGG + Intergenic
1082988719 11:59189152-59189174 ATCCCAGTGATTCCTGGAAGGGG - Exonic
1083004687 11:59332156-59332178 TTACCTGTGATAACTTGGAAGGG - Intergenic
1085593545 11:77788279-77788301 TTACCAGTAATTTCTGGGTCAGG - Intronic
1085836710 11:79964432-79964454 TCACCAGTGCTTCCTGGGAAGGG + Intergenic
1086628315 11:88986766-88986788 TTCCCAGTGATTTTTGGGGGAGG - Intronic
1088961342 11:114668813-114668835 TGTCCAGTTATTTCTGGGAGAGG - Intergenic
1093322539 12:17731330-17731352 TTGCCAGTGTTTACATGGAGGGG + Intergenic
1093476830 12:19565348-19565370 TTGCCAGTTATTTCTGGAAGTGG + Intronic
1093613250 12:21188776-21188798 TTGCCAGTGATTAAGGGGAAGGG - Intronic
1094017421 12:25879980-25880002 TTATCAGTGAATATTGTGAGGGG - Intergenic
1094142950 12:27199420-27199442 TTCCCAGTAAATACTGTGAGAGG - Intergenic
1096309407 12:50506603-50506625 ATACCAGTGATTCCCGGGACTGG - Intronic
1097523881 12:60705536-60705558 TTACCAGAGGCTACTGGGTGGGG - Intergenic
1099738926 12:86605730-86605752 ATACCAGTGCTTGCTGGGAATGG - Intronic
1100438484 12:94593717-94593739 TTACCACTGTTTCCTGGTAGAGG - Intronic
1101982979 12:109423595-109423617 TTTCCAGTGGCTGCTGGGAGGGG - Intronic
1110259305 13:73467339-73467361 TTACCAGGCATTTCTGGGGGCGG + Intergenic
1115674836 14:35661060-35661082 TTAACAGTGATTACAGGTACTGG + Intronic
1115856545 14:37635686-37635708 TTACCAGAGATGGCTGGGTGCGG + Intronic
1115869922 14:37788564-37788586 TTTCCAGTGATTCTTGGGAAAGG + Intronic
1121836976 14:97101212-97101234 TTACCAGAGCATACTGGGAAAGG + Intergenic
1125270401 15:37932713-37932735 CTACCATTAATTCCTGGGAGAGG + Intronic
1125479502 15:40070408-40070430 TTACCACTGCCTACTGGGATGGG - Intergenic
1127004691 15:54555030-54555052 TTATCAGTAATAATTGGGAGAGG + Intronic
1129087589 15:73112043-73112065 TTACTACTGGTTACTGGGAGAGG - Intronic
1130025683 15:80268695-80268717 TTACCAATGACTACTTGTAGGGG + Intergenic
1132359832 15:101202663-101202685 TTACCAGTGAGTGCTGCAAGGGG - Intronic
1135695580 16:24583344-24583366 TTACCAAAGAATCCTGGGAGGGG - Intergenic
1138556677 16:57775042-57775064 TTGCCAGTGTTTGCTGGGGGTGG + Intronic
1138866964 16:60833469-60833491 TTACCAATGACTACTCAGAGTGG - Intergenic
1139003401 16:62541469-62541491 TTACAAGTGTTTACTTGAAGAGG + Intergenic
1140234030 16:73142442-73142464 TTACCAGTGAGTACAGAGGGGGG + Intronic
1140476244 16:75240585-75240607 TTCCCAGTGATTACCGCGATTGG + Intronic
1141848950 16:86630864-86630886 TTACCAGGGCCTCCTGGGAGAGG - Intergenic
1143126437 17:4643812-4643834 GTAACTGTGATTGCTGGGAGTGG - Intergenic
1146675982 17:34774235-34774257 TTTCCAGGGATCTCTGGGAGGGG + Intergenic
1148986062 17:51622405-51622427 TTAGAAGTGATGACTTGGAGTGG + Intergenic
1149484238 17:57029612-57029634 TTAGGAGTGGTTAATGGGAGCGG - Intergenic
1149515169 17:57275639-57275661 TTACCAGGTATTGCTGGGAACGG + Intronic
1153547835 18:6227206-6227228 TTTCCATTGATTACTGAGAGAGG - Intronic
1154174199 18:12073646-12073668 TTAGCAGTCATTTCTGGGAGTGG - Intergenic
1156239361 18:35237991-35238013 TTACCAGTGATTAGTGAGTAAGG - Intergenic
1157765184 18:50291197-50291219 CTACCAAAGATTCCTGGGAGGGG + Intergenic
1157792119 18:50541995-50542017 CTAACAGTGCTTTCTGGGAGGGG - Intergenic
1163479990 19:17549555-17549577 ATGCCAGTGATTGCTGGGGGTGG + Intronic
1163576350 19:18113086-18113108 TGACCAGTTTTAACTGGGAGGGG + Intronic
1163650917 19:18517188-18517210 TGATGAGTGATTTCTGGGAGAGG - Intronic
1165814298 19:38632123-38632145 TTACCAGTGTAGGCTGGGAGTGG + Intronic
1166233200 19:41437916-41437938 GCACCAGTGTTTACTGGGATGGG + Intronic
1166601619 19:44100745-44100767 TGACCAATGATTCCTGGGAGAGG - Intronic
1166603394 19:44118132-44118154 TGACCAATGACTACTGAGAGAGG - Intronic
1167849630 19:52191431-52191453 TTAGCTGTAATTATTGGGAGTGG + Intronic
1168663827 19:58187305-58187327 TTACCAGTGATTATGAGGGGAGG - Intronic
926232493 2:11015125-11015147 CTAACAGTAATTACTGGCAGAGG + Intergenic
926470003 2:13243119-13243141 TGAGCAGTCATTACTGGGACTGG + Intergenic
926604465 2:14883671-14883693 TTAGCAGTCATTTCTGGGGGAGG - Intergenic
927374594 2:22399239-22399261 TTACCAGAGATTGAGGGGAGTGG + Intergenic
927412122 2:22838759-22838781 ATAACAGTGATTAGTGGGAGAGG + Intergenic
927584411 2:24287366-24287388 TTACCAGGGGTTAGAGGGAGGGG - Intronic
928256420 2:29726877-29726899 TTGCCAGTGAGTACTAGGATAGG + Intronic
929932152 2:46266369-46266391 TTCACAGAGATTACTGGGGGTGG - Intergenic
934769288 2:96897742-96897764 TGAGAAGAGATTACTGGGAGTGG - Intronic
935695556 2:105768079-105768101 TTTCATGTGGTTACTGGGAGAGG - Intronic
937777785 2:125800834-125800856 TTACCAGGGATTTAGGGGAGAGG + Intergenic
942814653 2:180037436-180037458 TTACCAGGGATTAAGGGAAGAGG + Intergenic
943463297 2:188196762-188196784 GTAACAGTGATTTCTGGAAGTGG - Intergenic
944076311 2:195735042-195735064 TCAACAGTGATTACTGGGAAAGG - Exonic
945279403 2:208021824-208021846 TTACCAATGATTGCTAGGTGGGG - Intronic
946202818 2:218080791-218080813 TCACCAGTGATTCCTGGCACTGG - Intronic
948555215 2:238805016-238805038 GTAGCAGTTATTTCTGGGAGGGG - Intergenic
1169636635 20:7699523-7699545 TTAGTAGTGATGACTGGCAGTGG - Intergenic
1170579043 20:17684196-17684218 TAACCAATGAGGACTGGGAGTGG - Intergenic
1172532181 20:35639705-35639727 TTAGCAGTGATTATTTGGGGTGG + Intronic
1174865269 20:54129782-54129804 TTGCCAGAGACTACAGGGAGAGG - Intergenic
1175747417 20:61467893-61467915 TTACCATTTATTACAGGGAAAGG + Intronic
1176056472 20:63151612-63151634 TTTCCAGAGAGTACTTGGAGGGG - Intergenic
1177767075 21:25471256-25471278 ATAGCAATGATTACTGGTAGGGG + Intergenic
1179414328 21:41186119-41186141 TTACCTGATATTACTGGGGGAGG + Intronic
1181322373 22:22018131-22018153 TTACCAGTGACTGATGGGTGAGG - Intergenic
1184414428 22:44343942-44343964 GCACCAGTGAGTACTGAGAGGGG - Intergenic
1184452654 22:44592076-44592098 TGACCTGTGACCACTGGGAGAGG + Intergenic
1184996343 22:48210077-48210099 TTCCCAGTGAGTACTGTGAATGG - Intergenic
950980080 3:17293970-17293992 TTACCAGTGATTCCCTAGAGGGG + Intronic
957574577 3:81991039-81991061 TTACCAGTTAGCACAGGGAGAGG - Intergenic
959859419 3:111199916-111199938 ATACCAGTCATTACTGGAAAGGG - Intronic
968085510 3:195872259-195872281 TGACGAGTGAGTACTGGGCGGGG - Exonic
971010904 4:22433737-22433759 TTAGCAGTCATTTCCGGGAGTGG - Intronic
972553216 4:40152809-40152831 TTGTCTGTGATTACGGGGAGAGG + Exonic
972744306 4:41918342-41918364 TTCCCAGTGATTACTGATATTGG - Intergenic
974445843 4:61980277-61980299 TTACCAGAGGTTAGTGGGAAAGG - Intronic
977682578 4:99812262-99812284 TCCCCAGTGATTTCTGGGAAGGG + Intergenic
981770691 4:148304375-148304397 TTACCAGTTTGTACAGGGAGAGG - Intronic
981776816 4:148378054-148378076 GAACCAGTGATTAATCGGAGTGG - Intronic
985041892 4:185899161-185899183 TTGCCTGTGAATGCTGGGAGGGG - Intronic
985952422 5:3233116-3233138 TTCCTATTGATCACTGGGAGAGG - Intergenic
987083675 5:14448835-14448857 TTACCAGTGATTACTGGGAGGGG - Intronic
989547191 5:42688362-42688384 CAACCAGTGAGTACTGGGAGCGG + Intronic
989810409 5:45665979-45666001 TTACAAGTACTTACAGGGAGCGG - Intronic
991297011 5:65092220-65092242 TTAGGAGTGGTAACTGGGAGAGG + Intergenic
991904264 5:71492963-71492985 TTATCAGTGGTTGCAGGGAGGGG - Intronic
992044922 5:72877823-72877845 CTACCAGTGATTACTCAGGGTGG - Intronic
995266076 5:110162424-110162446 TTAACAGTGGTTACTAGGGGTGG + Intergenic
995517022 5:112964308-112964330 TTACCAGTGAGTGATTGGAGAGG + Intergenic
998381706 5:141730430-141730452 TTTCCAGTGCTTACTTGGACTGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1000497497 5:162003060-162003082 TTTCCACTGATTACTGTTAGAGG + Intergenic
1000742407 5:164986275-164986297 ATACTAGTGAATACTTGGAGTGG + Intergenic
1003362075 6:5436714-5436736 TGACTAGTAATTACTTGGAGAGG + Intronic
1003943123 6:11047582-11047604 TAACCAGATATAACTGGGAGAGG + Intergenic
1004137205 6:12978908-12978930 TTCCTAGTGATTACTGGGCGTGG + Intronic
1004273790 6:14217887-14217909 TTACCAGTAATGCCTGGGAAGGG + Intergenic
1004932759 6:20477755-20477777 TTACTATTCATTACTGGAAGTGG + Intronic
1008505339 6:52224594-52224616 ATACCAGTGATTATTTGGGGGGG + Intergenic
1008912794 6:56754154-56754176 TTACCAGAGATCACTTGGAATGG - Intronic
1009411531 6:63370636-63370658 GCACCAGTGATTTCTGGGTGAGG - Intergenic
1011622034 6:89252068-89252090 TTCCTAGTGATTGGTGGGAGTGG + Intergenic
1012345467 6:98180012-98180034 TTAAAAGTGACTACTGAGAGTGG - Intergenic
1014109537 6:117604713-117604735 TAAAAAGTGATTACTGGGTGTGG - Intergenic
1014483190 6:121964426-121964448 TTATCAGTGTTTGCTGGGACTGG - Intergenic
1016280053 6:142406377-142406399 TCACCAGTGTTTGCTGGCAGTGG - Intronic
1017496870 6:154991275-154991297 TTACCTGTGAAAACTAGGAGAGG + Intronic
1017796735 6:157851502-157851524 TTACCAGGGGCTACAGGGAGTGG - Intronic
1021081949 7:16374950-16374972 TTACCAGTGTTTGATGGGAGTGG - Intronic
1021360019 7:19701358-19701380 TTGCCAGGGATTACAGGGAACGG + Intronic
1021792932 7:24224512-24224534 TTAACACTGCTGACTGGGAGTGG - Intergenic
1022613223 7:31898766-31898788 GTTTCTGTGATTACTGGGAGAGG - Intronic
1023291374 7:38671984-38672006 TTACCAATGACTAGTGGGTGTGG - Intergenic
1023952271 7:44856024-44856046 GTACCAGTAACTACTGGGCGCGG + Intergenic
1036396166 8:8373124-8373146 TTACCAGTGTGTACTGGAATTGG + Intronic
1039683477 8:39768802-39768824 TTACCAGGGACTTCAGGGAGGGG + Intronic
1041722998 8:60993171-60993193 TCACCACTGATTGGTGGGAGGGG + Intergenic
1045340823 8:101252927-101252949 TGACCAGTGATTACAGGGGCAGG - Intergenic
1045782370 8:105882161-105882183 TTACCAGTTAACACAGGGAGAGG - Intergenic
1045994440 8:108346013-108346035 TTACTAGTCATTACTGATAGAGG + Intronic
1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG + Intronic
1051464421 9:17360994-17361016 TTTCCATCAATTACTGGGAGAGG + Intronic
1052099783 9:24431595-24431617 TTACAAGTGCTTACATGGAGAGG - Intergenic
1052234572 9:26194453-26194475 TTTCCAGTGACTGGTGGGAGCGG - Intergenic
1055246234 9:74247140-74247162 TTACCAGTGACTAAGGAGAGGGG + Intergenic
1058456519 9:105142984-105143006 TTCCCAGAGATTATTGGGGGTGG - Intergenic
1058632794 9:107007025-107007047 TTACCGGAGTTTTCTGGGAGAGG + Intronic
1186985336 X:15007494-15007516 TTATCAGAAAGTACTGGGAGAGG + Intergenic
1187815932 X:23231821-23231843 TTACCACTGATTAAGGAGAGGGG + Intergenic
1189212203 X:39292932-39292954 TCACCAGTCATTCCTGGCAGAGG + Intergenic
1189999795 X:46674970-46674992 TTGCCAGTGAGGAATGGGAGGGG - Intronic
1194066323 X:89266720-89266742 TTACCAGTTTGTACAGGGAGAGG + Intergenic
1195418522 X:104647100-104647122 TTCACAGTGATTTCTGGGATAGG + Intronic
1195497168 X:105550034-105550056 TTAGGAGTGATTACTGGGTGTGG + Intronic
1195710493 X:107769463-107769485 TTACCAGGGGGTAGTGGGAGGGG + Intronic
1196677227 X:118432422-118432444 TAACCAGTCATCACTGGGAAGGG + Intronic
1197019929 X:121674801-121674823 TTACCTGTGAGTCCTGGGGGTGG + Intergenic
1197038720 X:121908549-121908571 TTACCAGTTTGTACAGGGAGAGG - Intergenic
1200720493 Y:6600839-6600861 TTACCAGTTTGTACAGGGAGAGG + Intergenic