ID: 987088193

View in Genome Browser
Species Human (GRCh38)
Location 5:14488200-14488222
Sequence CCGCATGAGCACGTGCTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987088190_987088193 -5 Left 987088190 5:14488182-14488204 CCCTGGCAAGGATACTGACCGCA 0: 1
1: 0
2: 0
3: 4
4: 63
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088179_987088193 26 Left 987088179 5:14488151-14488173 CCCTCCAGCGGCAGACACCCCGC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088185_987088193 8 Left 987088185 5:14488169-14488191 CCCGCCACGCGGCCCCTGGCAAG 0: 1
1: 0
2: 0
3: 13
4: 214
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088189_987088193 -4 Left 987088189 5:14488181-14488203 CCCCTGGCAAGGATACTGACCGC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088188_987088193 4 Left 987088188 5:14488173-14488195 CCACGCGGCCCCTGGCAAGGATA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088186_987088193 7 Left 987088186 5:14488170-14488192 CCGCCACGCGGCCCCTGGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 168
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088181_987088193 22 Left 987088181 5:14488155-14488177 CCAGCGGCAGACACCCCGCCACG 0: 1
1: 0
2: 1
3: 4
4: 58
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088191_987088193 -6 Left 987088191 5:14488183-14488205 CCTGGCAAGGATACTGACCGCAT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088180_987088193 25 Left 987088180 5:14488152-14488174 CCTCCAGCGGCAGACACCCCGCC 0: 1
1: 0
2: 2
3: 13
4: 134
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
987088184_987088193 9 Left 987088184 5:14488168-14488190 CCCCGCCACGCGGCCCCTGGCAA 0: 1
1: 0
2: 2
3: 30
4: 286
Right 987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987088193 Original CRISPR CCGCATGAGCACGTGCTCCT CGG Exonic
900237467 1:1599636-1599658 CCGTGCGAGCGCGTGCTCCTCGG - Exonic
900623605 1:3598333-3598355 GTGCATGAGCACGTGCTTCCGGG - Intronic
903130575 1:21277058-21277080 CAGCACCAGCACCTGCTCCTGGG + Intronic
909661785 1:78091530-78091552 CTGCAGGAGCAGGTCCTCCTCGG - Intronic
919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG + Intergenic
923502680 1:234578978-234579000 CCCCCTGCCCACGTGCTCCTGGG - Intergenic
1076145336 10:128114402-128114424 CCACATGAACACTTGATCCTTGG - Intronic
1076793790 10:132789308-132789330 CCGCCTGGGCCCGGGCTCCTGGG - Intergenic
1077333112 11:1992009-1992031 CTGCCTGAAAACGTGCTCCTGGG + Intergenic
1077432374 11:2522210-2522232 CCGCATGACCACGCCCTCTTGGG + Intronic
1089610369 11:119665325-119665347 CAGCATCAGCGTGTGCTCCTGGG + Intronic
1090803706 11:130189819-130189841 CAGCATGACTACGCGCTCCTCGG - Exonic
1202816094 11_KI270721v1_random:47187-47209 CTGCCTGAAAACGTGCTCCTGGG + Intergenic
1093096367 12:14976267-14976289 CAGCATGAGCAGGTGGTCCAGGG + Intronic
1103261659 12:119593928-119593950 GGGCATGGGCACGTCCTCCTCGG - Exonic
1113833064 13:113312152-113312174 CTGCAAGAGTACCTGCTCCTCGG - Intronic
1119175720 14:72566384-72566406 CCGCATGATCACGGACTCATCGG + Intronic
1123999082 15:25739920-25739942 CCGCAGCAGCAGGTGCTCCAGGG + Intronic
1124326109 15:28763941-28763963 CCGGATGTGCATGCGCTCCTGGG + Intergenic
1128682732 15:69663410-69663432 ACGCAAGAGCATCTGCTCCTAGG - Intergenic
1129892145 15:79078401-79078423 CGGCATGAGCACGTGCAGCCAGG - Intronic
1131260346 15:90884522-90884544 CCGCACGGGCAGCTGCTCCTGGG - Exonic
1135964824 16:27027233-27027255 CTGCAAGAGCACCTGCTCATTGG - Intergenic
1139345162 16:66298169-66298191 CCACCTGAGCACTTCCTCCTGGG - Intergenic
1144608684 17:16689896-16689918 CCGCCGGCGCACCTGCTCCTAGG - Intergenic
1145128459 17:20320811-20320833 CCGCCGGCGCACCTGCTCCTAGG - Intergenic
1145196151 17:20896403-20896425 CCGCCGGTGCACCTGCTCCTAGG + Intergenic
1146891013 17:36506546-36506568 CCCCATGAGCAGGGGGTCCTGGG + Exonic
1149515953 17:57281003-57281025 CTGCAAGAGCACCTCCTCCTTGG - Intronic
1153528194 18:6017060-6017082 CCTCATGACCACGGGCTCCAGGG - Intronic
1153811959 18:8759911-8759933 CCCCATGAGCATGAGCCCCTGGG - Intronic
1154297231 18:13161838-13161860 CCTTGTGAGCACGGGCTCCTTGG + Intergenic
1157248188 18:46071844-46071866 CCTCAGGAGCACGCGCTGCTGGG + Intronic
1159822847 18:73167664-73167686 CAGCATGAGCATGTTTTCCTTGG - Intronic
1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG + Intronic
1166731381 19:45060865-45060887 CCGCCTGTGCATGGGCTCCTGGG - Intronic
1168281616 19:55308860-55308882 CAGCATGAGCAGGTGCTCTGGGG + Intronic
932089015 2:68788318-68788340 CTGCATGAGCCAGTGCTGCTGGG - Intronic
938133297 2:128735234-128735256 TCCCAGGAGCACGTGCTACTTGG - Intergenic
946334049 2:219025840-219025862 CCGGCTGAGGACTTGCTCCTGGG - Intronic
948663759 2:239522078-239522100 TCCCATGATCACATGCTCCTAGG - Intergenic
1169026433 20:2375282-2375304 CCACATAAGCAAGTGCTCTTTGG - Intergenic
1178669049 21:34574769-34574791 GCGGCTGAGCACGTTCTCCTCGG + Intronic
1180182811 21:46125395-46125417 CTGCATGTGCACGTGACCCTAGG + Intronic
1181132201 22:20738605-20738627 CTGAATGACCACGTGCTGCTGGG + Intronic
1181265664 22:21629307-21629329 CAGCACGTGCACGTGCTCCCAGG - Exonic
1181669026 22:24417382-24417404 CCACATGAGGAAGTGCGCCTTGG - Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184557877 22:45242816-45242838 CAGCATGAGCGAGTGCTCCAAGG + Intergenic
1185068804 22:48645136-48645158 CCACATGGGCACCTGCTCCCTGG - Intronic
957997233 3:87705957-87705979 CAGCATCAGCATCTGCTCCTGGG - Intergenic
967098123 3:186193982-186194004 ACGCATGAAATCGTGCTCCTGGG + Intronic
968621505 4:1605347-1605369 TCTCCTGAGCACTTGCTCCTGGG - Intergenic
969628952 4:8324208-8324230 CCCCATGAGCAAGTGCTTCTTGG - Intergenic
974235499 4:59176037-59176059 CTGCATGAGCAAGTGATTCTTGG + Intergenic
987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG + Exonic
997103818 5:130995924-130995946 CTTCATCAGCACGTTCTCCTCGG - Intergenic
997674221 5:135700833-135700855 CCACTTGTGCACGTGCTCCGAGG + Intergenic
1001101694 5:168819564-168819586 CCACATGCACACATGCTCCTTGG - Intronic
1006242905 6:32701797-32701819 CAGCAAGAGCACTTACTCCTAGG - Intergenic
1007154007 6:39724967-39724989 CCGCGTGAACACGTGTGCCTGGG + Intronic
1008086324 6:47248616-47248638 CTGCCTGAGCACATGTTCCTAGG - Intronic
1018754594 6:166838027-166838049 CTGCATGAGCACAGGCTCCTTGG + Intronic
1019307759 7:343990-344012 CCCCATGAGCACAGACTCCTCGG - Intergenic
1019807520 7:3139191-3139213 TCACATGAACACGTGCTTCTGGG + Intergenic
1020141578 7:5614843-5614865 CCAGAAAAGCACGTGCTCCTTGG + Intergenic
1022036930 7:26543337-26543359 CTGCATGACCGTGTGCTCCTGGG + Intergenic
1024729035 7:52234335-52234357 CCCCATAAGCACCTGCTCATAGG - Intergenic
1028540828 7:91940797-91940819 CCTCGTGGGCAGGTGCTCCTGGG - Intergenic
1030358906 7:108574642-108574664 CAGCAGGAACACTTGCTCCTAGG - Exonic
1032077268 7:128842067-128842089 CCGCCAGAGCACGTGGCCCTGGG + Intronic
1034338725 7:150339202-150339224 CTGCATGACCTCTTGCTCCTGGG - Intronic
1036560066 8:9894231-9894253 CCCCACGAGAACTTGCTCCTGGG + Intergenic
1042802941 8:72740535-72740557 CCCCATGAGAACTTGCTCTTTGG - Intronic
1043415838 8:80048141-80048163 ACTCATGACCACGTCCTCCTTGG + Intronic
1047211224 8:122842044-122842066 ACAAATGAGCACGAGCTCCTGGG + Intronic
1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG + Exonic
1050041902 9:1504401-1504423 GAGCCTGAGCAAGTGCTCCTGGG - Intergenic
1050160872 9:2717817-2717839 CCGCAGGAGCATTTGCTCCCTGG + Exonic
1052824157 9:33163302-33163324 GCTCATGAGCAAGTGCTCCTCGG + Intronic
1062438362 9:136557098-136557120 CAGCATGAGCCCCAGCTCCTTGG + Intergenic
1062631054 9:137463368-137463390 CGGCAGGAGCACAGGCTCCTGGG - Intronic
1187496780 X:19802403-19802425 CTGAATGAGCACCTGCTCCCAGG - Intronic
1190104925 X:47553138-47553160 CCTCCTGAGCCCTTGCTCCTTGG + Intergenic
1192491396 X:71579467-71579489 CAGCACCACCACGTGCTCCTAGG - Intronic
1196513859 X:116546659-116546681 CCTCATGAGCCCATGCTACTGGG - Intergenic