ID: 987093264

View in Genome Browser
Species Human (GRCh38)
Location 5:14525943-14525965
Sequence GTTTCAGGAGGTTTACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987093264 Original CRISPR GTTTCAGGAGGTTTACTGGC AGG (reversed) Intronic
900737778 1:4310016-4310038 GGTTCAGGATGCTTGCTGGCTGG + Intergenic
901362747 1:8716924-8716946 ATTTCAGGAGTCTTACTAGCAGG - Intronic
902280625 1:15371679-15371701 GTTCCAGGTTGTTTACTGCCGGG + Intronic
905179691 1:36157856-36157878 GTTTCAGGAGGCTTGTAGGCTGG + Intronic
905442049 1:38001757-38001779 GCTCCAGGAGGTTCACTGGGAGG - Intronic
908721633 1:67132221-67132243 GTTTTAAGAGGTTTACTCGCTGG + Intronic
909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG + Intronic
910690446 1:89960000-89960022 GTTTCAGGAGCTGTAGTGCCAGG + Intergenic
910732297 1:90411395-90411417 GTGTCAGTTGGTTTACTTGCGGG + Intergenic
910926893 1:92406946-92406968 GTTTCATGACGTTTACTGCAAGG - Intergenic
911219557 1:95233422-95233444 GCTTCAGGATGTTGACTGGACGG - Intronic
917081240 1:171258809-171258831 GTCTCAGCAGGGTTACTGCCTGG + Intronic
917460399 1:175224307-175224329 GTTTCACCATGTTTACAGGCTGG - Intergenic
918957359 1:191226124-191226146 ATTTAAGGAGGTAGACTGGCTGG + Intergenic
919029126 1:192216677-192216699 GTATCAGCAGGTTTAGTGTCTGG + Intergenic
920657521 1:207887783-207887805 GTTTCTGGAGGTGGCCTGGCCGG + Exonic
922997696 1:229978671-229978693 GTTTCAGGAGGTTTTCTTGTTGG - Intergenic
1063017525 10:2093742-2093764 ATATCAGAAGGTTTACTCGCTGG - Intergenic
1063850700 10:10186578-10186600 GTTTCTGGAGCATTTCTGGCTGG + Intergenic
1064347021 10:14541495-14541517 GTGCCTGGAGTTTTACTGGCTGG - Intronic
1066153670 10:32651564-32651586 GTTTCTGGAGGATTTCGGGCAGG + Intronic
1070772749 10:79091887-79091909 GTTTTAGGAGATTTAGTGACAGG + Intronic
1072319811 10:94238067-94238089 GTTTCTAGTGGTTTTCTGGCAGG - Intronic
1073210290 10:101795599-101795621 ATTTCAGGGGGTTTACTGATTGG - Intronic
1074151586 10:110764143-110764165 GTTTCAGGAGCTTTGCTGGCTGG + Intronic
1079087171 11:17454726-17454748 GTTTCAGTAGGGTTAGTGGCTGG + Intronic
1081600804 11:44492394-44492416 CTTGCAGGAGGTTTATTGGAGGG - Intergenic
1087221325 11:95549502-95549524 GTTTCAGGAGAAATTCTGGCAGG + Intergenic
1087514494 11:99141118-99141140 GGTCCAGGATGTTTACTGGTTGG + Intronic
1088167987 11:106961161-106961183 ATTTCAGGAGGGTGAGTGGCAGG - Intronic
1089246620 11:117125666-117125688 GTCTAAGGAAGTTTATTGGCAGG + Intergenic
1091954513 12:4627202-4627224 GCTACAGGAGGTTCATTGGCAGG + Exonic
1092728407 12:11506384-11506406 GTTTCAGAAGGTTTTCTGAAAGG - Intergenic
1093709551 12:22314322-22314344 GTGTTAGGAGGCATACTGGCTGG - Intronic
1096004801 12:48160809-48160831 ATCTGAGGAGGTTTACTGCCTGG - Intronic
1096080029 12:48827036-48827058 GTACCTGGAGGTTTACTGGCGGG + Exonic
1101810326 12:108102264-108102286 TTTTCTGGATGTTTGCTGGCTGG + Intergenic
1106846773 13:33745214-33745236 GCTTCAGGAGGATTCCAGGCAGG + Intergenic
1110681546 13:78319406-78319428 GCTTCAGGAGGTTTCCAGACAGG - Intergenic
1113214515 13:108023146-108023168 GTTTCTGGAGGTTTTTTGGGGGG + Intergenic
1117711715 14:58537132-58537154 GATTTACGAGGTTTACTGGAAGG - Intronic
1121187103 14:91983216-91983238 CCTTCAGGAGGTTTACAGTCAGG - Intronic
1124353465 15:28977652-28977674 GCTTCAGGAGGTTTATGTGCTGG - Intronic
1125268014 15:37906205-37906227 GTTTAAGGAGAGTTACTGCCTGG - Intergenic
1127535919 15:59889815-59889837 GTTCCAGGAGATTTGCTGTCTGG - Intergenic
1131903263 15:97112460-97112482 GTTTAAAGAGGTCTCCTGGCCGG + Intergenic
1134570216 16:15284318-15284340 GGTGCAGGGGGTTTACTGGGAGG + Intergenic
1134732159 16:16471735-16471757 GGTGCAGGGGGTTTACTGGGAGG - Intergenic
1134935278 16:18240228-18240250 GGTGCAGGGGGTTTACTGGGAGG + Intergenic
1135874080 16:26181110-26181132 GATTCAGGAGGTTTAAGGGGAGG + Intergenic
1138393791 16:56689358-56689380 GTCTCAGGAAGTCCACTGGCTGG + Intronic
1143317083 17:6040955-6040977 GGTTCAGGCTGTTTTCTGGCTGG + Intronic
1143415738 17:6748073-6748095 GTTGCAGGCAGTTAACTGGCGGG - Intergenic
1143958552 17:10695773-10695795 ATTGGAGGAGCTTTACTGGCTGG - Exonic
1144222635 17:13113841-13113863 GTGTCAGAAGTTTAACTGGCAGG + Intergenic
1145278244 17:21449115-21449137 GTGTCAGGAAGCTTCCTGGCAGG - Intergenic
1145316065 17:21735014-21735036 GTGTCAGGAAGCTTCCTGGCAGG - Intergenic
1145714493 17:27006935-27006957 GTGTCAGGAAGCTTCCTGGCAGG - Intergenic
1147864555 17:43544208-43544230 TGTTCAGGAGGTTTCCTGGTTGG - Intronic
1149822684 17:59794735-59794757 GTTTCAGGAGGCTTTCTCGGGGG - Intronic
1150287165 17:63960971-63960993 GTTTCAGGACATTTAGGGGCAGG - Intronic
1151093546 17:71470212-71470234 GTTACCGGAGGATTGCTGGCTGG + Intergenic
1151581380 17:74981242-74981264 GTTTTAGGAGTTTTTCAGGCAGG + Intergenic
1152729484 17:81962394-81962416 GGTTCAGGAGGTTTCCTGCTGGG + Intergenic
1154110838 18:11567313-11567335 GTTTCAGGATTTTTACTGCTAGG + Intergenic
1154363949 18:13689202-13689224 TTCTCAGGAGGTTTAGTGACAGG - Intronic
1155793507 18:30004250-30004272 GTTTCTGGAGCTTTTCTGCCTGG + Intergenic
1156367399 18:36441500-36441522 GCTTCAGGAGGTTTTCTAGGAGG + Intronic
1157043174 18:44063370-44063392 GATTCAGTAGGTTTAGTGGTAGG + Intergenic
1166015545 19:39976803-39976825 TTTTAAGAAGGTTTACGGGCTGG - Intronic
1168130110 19:54312425-54312447 GTTTTAGGAGGTTCCCAGGCAGG - Intronic
1168134063 19:54338666-54338688 GTTTGAGTAGGTTTTCTGGAAGG + Exonic
925812165 2:7711421-7711443 GTTTCAGAATGATGACTGGCAGG + Intergenic
929184361 2:39078478-39078500 GTTTGAGGAGATTTATTGGTTGG - Intronic
936165039 2:110114031-110114053 CTTCCAGGAGTTTCACTGGCAGG + Intronic
939931579 2:148240745-148240767 GTTTCTTCAGGTTCACTGGCTGG + Intronic
941666567 2:168248073-168248095 GTTTCCGGCGCTTTACTTGCCGG + Exonic
941938297 2:171004529-171004551 GTTTCAGGGGCTGTACTGGAAGG - Intronic
944866871 2:203871010-203871032 ATTTCAGGAGGTTTACTTTTAGG + Intronic
948970317 2:241420733-241420755 TTTTTAGCAGGTTTACTGCCTGG + Intronic
1168807360 20:679826-679848 GTTTCAGGAAGTTCACTGTGGGG + Intergenic
1169352776 20:4882864-4882886 GTTTTAGGAGTTGTACTGGCTGG + Intronic
1173126929 20:40345808-40345830 GGTCCATGAGGATTACTGGCAGG - Intergenic
1174310315 20:49648232-49648254 GTTTCAGGATGTTTATAGTCAGG - Intronic
1175320501 20:58084424-58084446 GCTTCAGGAGGTGTTCTGGGTGG + Intergenic
1175971817 20:62690188-62690210 GGGGCAGGAGGTTTACTGGGAGG - Intergenic
1183972693 22:41489840-41489862 GTTTCAGCAAGTTTACTTACAGG - Intronic
950657628 3:14446612-14446634 GGTTCAGGAGGCTTTCTGTCTGG + Intronic
951667417 3:25142725-25142747 GTTTCTGGAGGCTTTCTGGGAGG - Intergenic
954187233 3:48926844-48926866 GTTTAAAGAGTTCTACTGGCCGG - Intronic
955451543 3:59073295-59073317 TTTTTAGCAGGTTTACTGGGTGG - Intergenic
959859683 3:111203454-111203476 GTTCCAGGAAGTTTTCTGGATGG - Intronic
962438952 3:135394362-135394384 GTTTCTGGAGGTTTTCTCGAGGG + Intergenic
963043669 3:141087225-141087247 GCTGCAGTAGGTTGACTGGCCGG + Intronic
965393672 3:168135370-168135392 GTGTAAGGAGGTTTAATTGCAGG + Intergenic
971254675 4:25003564-25003586 GTTTAAGGAGATTTACGTGCAGG - Exonic
979358787 4:119736771-119736793 CTTTCTGGAGGTTTTCTAGCTGG - Intergenic
982997335 4:162366273-162366295 GATTCAGGAGGTATACATGCAGG + Intergenic
983738720 4:171099652-171099674 GTTTCAGGAGAATTACTTTCTGG - Intergenic
984596628 4:181676392-181676414 GTTTCAGGAGGTATATGTGCAGG + Intergenic
986595729 5:9419980-9420002 GTTTCAGGATGTGTACTGTTGGG + Intronic
987093264 5:14525943-14525965 GTTTCAGGAGGTTTACTGGCAGG - Intronic
987785240 5:22491008-22491030 GATTCAGGAGGTCCACTTGCAGG + Intronic
988595039 5:32583412-32583434 GTTTCATCAGGTTTGCAGGCTGG + Intronic
990942040 5:61212693-61212715 GTTTCAGGAGGTCTGCTTTCTGG - Intergenic
991307663 5:65197058-65197080 TTTTCAGGTGGCTTACTGTCAGG + Exonic
992560610 5:77949263-77949285 CTTGCAAGAGGTTTACTGGAGGG + Intergenic
995841813 5:116449375-116449397 GTTTCATGTATTTTACTGGCAGG + Intronic
997632028 5:135376020-135376042 TTTTCAGGAGGTTGAGTGGCAGG + Intronic
999467731 5:151823095-151823117 GTTTCTGGAGGCTTTTTGGCTGG + Intronic
1001582323 5:172807287-172807309 GTTTCAGCAGGCTTACTTCCTGG + Intergenic
1002086781 5:176780853-176780875 GTATCAGGCGGGTTTCTGGCAGG - Intergenic
1007615394 6:43176731-43176753 GTTACAGGAGGGTTACTGTTGGG - Intronic
1013293082 6:108735483-108735505 GTATCAGGAGTTTTACAGCCAGG + Intergenic
1015314107 6:131797537-131797559 GTGTCTGGATGTTTACTGGCAGG - Intergenic
1018196619 6:161361053-161361075 GTATAAGGAGGTTTTCTGGTGGG + Intronic
1023058170 7:36306194-36306216 GTTTCAGGAATTTTACCAGCCGG + Intergenic
1026059579 7:67014144-67014166 ATACCAGGAGGTATACTGGCAGG + Intronic
1030892083 7:115011135-115011157 GTCTCAGGAGGTTAACTGCCTGG + Intronic
1031529291 7:122856514-122856536 GTTCCAGGAAGATTAGTGGCAGG - Intronic
1033004662 7:137548567-137548589 GCTTCAGGAAGTTTACAGTCAGG - Intronic
1034588516 7:152118141-152118163 GTATCAGGATGTTTAGTGTCAGG + Intronic
1036587488 8:10137765-10137787 GTTTCAGGGGGTTACCTGGAAGG - Intronic
1037511417 8:19587002-19587024 ATTTCAAGAGGTTTCCTGGAAGG + Intronic
1037649243 8:20821837-20821859 GTGTCAGGAAGTTTCCTGCCTGG - Intergenic
1039745066 8:40418006-40418028 GTTTCAGGAATTTTTCAGGCAGG - Intergenic
1040648654 8:49426554-49426576 CTTACATGAGGTTTCCTGGCTGG + Intergenic
1041617156 8:59920872-59920894 CTTTCAGGAAGGTTGCTGGCAGG - Intergenic
1042549263 8:69979935-69979957 TGTTCAGGAGGTTTGCAGGCAGG + Intergenic
1048567940 8:135623391-135623413 GTTTCATAAGGTTTACTGTGCGG - Intronic
1048687595 8:136921278-136921300 GTATGAGGAGTTTTACTGGAAGG - Intergenic
1049214890 8:141402969-141402991 GTCTCAGGAGGGTCCCTGGCTGG + Intronic
1052803686 9:32993401-32993423 GTTTATGGAGTTTTACTGGAGGG - Intronic
1053654345 9:40200513-40200535 ATTACAGGAGGTGTACTGTCAGG + Intergenic
1055699277 9:78924813-78924835 ATTTCAAGAGGTTTATTGGATGG - Intergenic
1056766727 9:89448688-89448710 GTTTCACGGGCTTCACTGGCGGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1186863476 X:13695954-13695976 TTTTCAAGAGGATTACTGCCAGG + Intronic
1188850190 X:35122618-35122640 GTTTCAGGTGGCTTACTCCCTGG - Intergenic
1196663761 X:118295011-118295033 GTTTCAGTAGATTTACTAACTGG - Intergenic
1199661047 X:150051610-150051632 GTGTCAGGAGCTGCACTGGCAGG + Intergenic
1200064852 X:153499467-153499489 CTTTCCAGAGGTTTTCTGGCAGG - Intronic
1201927183 Y:19300026-19300048 ATTTTAGGAGGTTTATTCGCTGG + Intergenic