ID: 987095691

View in Genome Browser
Species Human (GRCh38)
Location 5:14547198-14547220
Sequence AAAGCTGGAGAGTTTAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987095691_987095694 29 Left 987095691 5:14547198-14547220 CCAAGATTAAACTCTCCAGCTTT No data
Right 987095694 5:14547250-14547272 ATATATCTTGTAGATATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987095691 Original CRISPR AAAGCTGGAGAGTTTAATCT TGG (reversed) Intergenic
No off target data available for this crispr