ID: 987097435

View in Genome Browser
Species Human (GRCh38)
Location 5:14562183-14562205
Sequence CTGGGGGGATGGAGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987097425_987097435 13 Left 987097425 5:14562147-14562169 CCAGATGAAAGAAGTGGGATTAG No data
Right 987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG No data
987097421_987097435 18 Left 987097421 5:14562142-14562164 CCCACCCAGATGAAAGAAGTGGG No data
Right 987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG No data
987097424_987097435 14 Left 987097424 5:14562146-14562168 CCCAGATGAAAGAAGTGGGATTA No data
Right 987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG No data
987097419_987097435 22 Left 987097419 5:14562138-14562160 CCAGCCCACCCAGATGAAAGAAG No data
Right 987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG No data
987097423_987097435 17 Left 987097423 5:14562143-14562165 CCACCCAGATGAAAGAAGTGGGA No data
Right 987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987097435 Original CRISPR CTGGGGGGATGGAGGGGAGA TGG Intergenic
No off target data available for this crispr