ID: 987100022

View in Genome Browser
Species Human (GRCh38)
Location 5:14582729-14582751
Sequence TGCTTGAACCCGGCGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152240
Summary {0: 3, 1: 127, 2: 6331, 3: 40070, 4: 105709}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987100015_987100022 8 Left 987100015 5:14582698-14582720 CCAGCTACTCGGAAGGCTGAGGC 0: 2457
1: 104918
2: 267286
3: 217176
4: 132007
Right 987100022 5:14582729-14582751 TGCTTGAACCCGGCGGGCGGAGG 0: 3
1: 127
2: 6331
3: 40070
4: 105709
987100013_987100022 9 Left 987100013 5:14582697-14582719 CCCAGCTACTCGGAAGGCTGAGG 0: 2685
1: 112021
2: 295213
3: 222777
4: 120667
Right 987100022 5:14582729-14582751 TGCTTGAACCCGGCGGGCGGAGG 0: 3
1: 127
2: 6331
3: 40070
4: 105709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987100022 Original CRISPR TGCTTGAACCCGGCGGGCGG AGG Intronic
Too many off-targets to display for this crispr