ID: 987101621

View in Genome Browser
Species Human (GRCh38)
Location 5:14596262-14596284
Sequence CTGTGGAAGGCTTGGTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 199}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987101621_987101627 -7 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101627 5:14596278-14596300 TCCACAGGCATCCCTCTCCAGGG 0: 1
1: 0
2: 0
3: 53
4: 335
987101621_987101626 -8 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101626 5:14596277-14596299 TTCCACAGGCATCCCTCTCCAGG No data
987101621_987101631 3 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101631 5:14596288-14596310 TCCCTCTCCAGGGATGAGGCGGG No data
987101621_987101635 11 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101635 5:14596296-14596318 CAGGGATGAGGCGGGAAAGCTGG 0: 1
1: 0
2: 2
3: 45
4: 442
987101621_987101630 2 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101630 5:14596287-14596309 ATCCCTCTCCAGGGATGAGGCGG 0: 1
1: 0
2: 3
3: 25
4: 226
987101621_987101629 -1 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101629 5:14596284-14596306 GGCATCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 3
3: 40
4: 218
987101621_987101638 18 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101638 5:14596303-14596325 GAGGCGGGAAAGCTGGGCCAGGG 0: 1
1: 0
2: 5
3: 39
4: 353
987101621_987101637 17 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101637 5:14596302-14596324 TGAGGCGGGAAAGCTGGGCCAGG No data
987101621_987101636 12 Left 987101621 5:14596262-14596284 CCCAATCACCAAGCCTTCCACAG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 987101636 5:14596297-14596319 AGGGATGAGGCGGGAAAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987101621 Original CRISPR CTGTGGAAGGCTTGGTGATT GGG (reversed) Intronic
901860315 1:12070142-12070164 CTGTGGGGGGCTGGGGGATTGGG + Intronic
901938777 1:12645978-12646000 CTGAGCAGGGCTTGGGGATTGGG + Intronic
902413483 1:16225741-16225763 CTGTGGAAGGGTTGGGGGATGGG - Intergenic
902703946 1:18191625-18191647 CTGTGGCAGGCTTGCGGGTTGGG + Intronic
904292905 1:29499096-29499118 TTCTGGAAGGCTTGCAGATTAGG + Intergenic
905105770 1:35562717-35562739 CTGTGCCAGGCTTCCTGATTGGG + Intronic
905812444 1:40922639-40922661 GTGAGGAAGGCTTAGTGACTGGG + Intergenic
908202303 1:61810243-61810265 CTGAGGAAAGCTTGGTCAGTTGG - Intronic
909390980 1:75121678-75121700 CTGTTGAAAGAGTGGTGATTGGG - Intergenic
909571841 1:77121841-77121863 CTTTGCAAGGGTTGATGATTGGG + Intronic
910681135 1:89866300-89866322 ATGAGGAATGCTTGGTGATGTGG + Intronic
919527247 1:198668804-198668826 CTGTGGAAGGATTAGTCTTTAGG + Intronic
920548106 1:206835499-206835521 CTGAGGAAGGCATGGGGAGTGGG + Intronic
920657040 1:207885003-207885025 CTTTGGAATTCTGGGTGATTGGG + Intronic
922395390 1:225195080-225195102 CTGTGGAAAGCACAGTGATTTGG + Intronic
924092683 1:240518016-240518038 CTGTTGAAAGCTGGGGGATTAGG - Intronic
1063049381 10:2430224-2430246 CTGTGGGAGGCTGTGTGATTGGG - Intergenic
1064092323 10:12395612-12395634 CTGTAGAAGGGTTGGTTTTTCGG + Intronic
1064162176 10:12956191-12956213 CTGGGGTAGGGTTGGTGGTTTGG - Intronic
1064593147 10:16915402-16915424 ATGAGGAAGGCTTGCTCATTTGG + Intronic
1070724426 10:78778581-78778603 CTGTGGAAGGATTGATGCTGGGG + Intergenic
1071363301 10:84873240-84873262 CTGTGGAAGGGAGGTTGATTTGG + Intergenic
1071752873 10:88501387-88501409 CTGTGGAAGGCATAGTGTTTGGG - Intronic
1072723005 10:97792259-97792281 CAGTGGGTGACTTGGTGATTTGG + Intergenic
1072825152 10:98598910-98598932 CTGGGGTTGGCTTGGAGATTGGG + Intronic
1075396803 10:122133619-122133641 CTGGGGAAGCCATGGTGAATAGG + Intronic
1075540285 10:123307050-123307072 TTGTGGAAGGAGAGGTGATTGGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077293086 11:1809040-1809062 CAGTGGAAGGATTGATGAGTTGG + Intergenic
1077459784 11:2703224-2703246 TTGTGGAAGGCTTTGAAATTTGG + Intronic
1077600889 11:3573717-3573739 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1078230823 11:9440938-9440960 CTGAGGAAAGCTGGGAGATTGGG - Intronic
1078795968 11:14591879-14591901 CTGTGGAAGGTTTGTTCTTTTGG + Intronic
1078872940 11:15365775-15365797 TTGTGGGAGGTTAGGTGATTTGG + Intergenic
1081854986 11:46297214-46297236 CTGTGGCTGGCTGGGTGGTTGGG + Intronic
1083397281 11:62400525-62400547 CTGTGCAAGGCTTGGGCACTGGG + Intergenic
1083863930 11:65443280-65443302 CTGTGGACTGCTTGCTGCTTGGG + Intergenic
1084315315 11:68342392-68342414 CTGTGGAACTCTGGGTGATGGGG - Intronic
1084971158 11:72772796-72772818 CTGAGAAAGTCTTGGTGAGTTGG - Intronic
1085060236 11:73439192-73439214 CAGTGGAAGGCTGGGTGGCTGGG - Intronic
1085125117 11:73995922-73995944 CTGTGAAAGCCTTCTTGATTTGG - Intergenic
1086664856 11:89467668-89467690 CTTTGGGTGACTTGGTGATTAGG - Intronic
1089538587 11:119175489-119175511 CTGGGGAAGGCTTGGTGGCTGGG + Intronic
1090008851 11:123027800-123027822 CTGTGGAAGCCGTGGTGAGATGG + Intergenic
1091856811 12:3747115-3747137 CTGTGGAACGCTTGAGGACTTGG + Intronic
1092427044 12:8383076-8383098 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1092685973 12:11046704-11046726 CTGTGGGAGGCTTGGTCCTATGG + Intronic
1096527707 12:52221985-52222007 CTGAAGAAGCCTTGGTGATATGG + Intergenic
1097035667 12:56121927-56121949 ATGGGGAAGGCTAGGTGAGTGGG - Exonic
1098192178 12:67961043-67961065 CTGTGGAAAGCTTGGGGCCTAGG + Intergenic
1099623051 12:85028528-85028550 CTGTTGAATGCTTGGTGCTATGG + Intronic
1104271886 12:127289719-127289741 CTGTGGAATGCCTGGTGGCTGGG - Intergenic
1106371294 13:29136447-29136469 CTGATGAAGCCTTGGTCATTCGG - Intronic
1113071303 13:106423893-106423915 CTGTGGAAGGCCTGGGAAGTAGG + Intergenic
1114890237 14:26911673-26911695 CTCTGGAAGGGCTGGTGATTGGG + Intergenic
1116986639 14:51226942-51226964 CTGAGGAAAGCCTGGTTATTTGG + Intergenic
1122540284 14:102494111-102494133 CTCTGGAAGCCTTCGTGAGTGGG - Intronic
1122852338 14:104543351-104543373 CTGTGGAAGGTCTGGCTATTTGG - Intronic
1122976635 14:105173569-105173591 CTCTGGAGGGCTTCGTGATCGGG - Intronic
1122984298 14:105205229-105205251 CTGTGGAAGGCTGGGGAAGTTGG + Intergenic
1123932253 15:25177548-25177570 CTGGAGAAGGGTGGGTGATTCGG + Intergenic
1124581344 15:30957970-30957992 CTGAGGAGGGATTGGTGATGGGG + Intronic
1124588937 15:31036372-31036394 CTGTGGAAGGCTTGGGGGAGGGG + Intronic
1127271452 15:57405565-57405587 GTGTGGTAAGCTTGGTGAGTGGG + Intronic
1128213769 15:65920226-65920248 CTGTGGCAGGCTGGCTGATTTGG + Intronic
1128456109 15:67832377-67832399 TGGTGGAAGGCTCGGTGATGAGG - Intronic
1130449775 15:84039405-84039427 ATGTGGAGGGTTTGGTGATTGGG + Exonic
1130684643 15:86026014-86026036 CTGTGGAAAGCTGGGTGCTGTGG + Intergenic
1131310404 15:91285488-91285510 CTGCTGAAAGCTTGGTGTTTGGG - Intronic
1133700267 16:8302154-8302176 CTGCTGATGGCTTGGTGCTTAGG - Intergenic
1137513842 16:49125364-49125386 CCAAGGAAGGCTTGGTTATTTGG - Intergenic
1140950561 16:79812870-79812892 CGGTGGCAGCCCTGGTGATTTGG - Intergenic
1141014830 16:80439242-80439264 ATGGGGAAGGCTGGCTGATTTGG - Intergenic
1141287224 16:82683700-82683722 GTGTGGATAGCTTGGTGAATAGG - Intronic
1141498001 16:84423363-84423385 CTGCATAAGGCTTGGGGATTGGG + Intronic
1141945938 16:87310380-87310402 AGGGGGAAGGCCTGGTGATTGGG + Intronic
1143811938 17:9478898-9478920 CTGTGGAAGGGATGGTGAGGAGG - Intronic
1144662937 17:17083035-17083057 CTGTGGCAGGCATGGTGCTGAGG + Intronic
1147048917 17:37776497-37776519 CTGTGGAAGGCATAGGAATTTGG - Intergenic
1152886067 17:82850700-82850722 CTGTGCATGGACTGGTGATTTGG + Intronic
1153308568 18:3655120-3655142 ATGTGGCTGGCTTGGTGAATGGG - Intronic
1155505749 18:26531007-26531029 CTGTGGCAGGCATGGGGAATAGG + Intronic
1156474521 18:37397326-37397348 CTGTGGTAGGCCTGGGGCTTGGG + Intronic
1159314761 18:66757650-66757672 CTGTGGAAGGAATGTTGAGTTGG - Intergenic
1162728121 19:12701901-12701923 CTGTGGAGGGCTGGGTCACTGGG + Intronic
1163101304 19:15098711-15098733 CTGTGGCAGTCATGGTGAGTTGG - Intergenic
1164677363 19:30110612-30110634 CTGTGAAAGGGTTTGTGCTTTGG + Intergenic
1165816992 19:38648351-38648373 GTGTGGAGGGGTTGGTTATTTGG + Intronic
1167357689 19:49014308-49014330 CTGTGGAAGGCTGCGTCATCAGG + Intronic
925347871 2:3183276-3183298 GTGTGGATGGATTGGTGAATGGG - Intergenic
925566159 2:5256694-5256716 CTTTGGCAGGCATGGTGATAAGG + Intergenic
926885773 2:17597217-17597239 CTGGGGAAGGGTTTGTGCTTAGG - Intronic
927932385 2:27053348-27053370 GTGTGGAAGGGTTGGAGATATGG - Intronic
932429900 2:71667937-71667959 CTGTGGGTGGCTTTGTCATTTGG - Intronic
934015138 2:87872673-87872695 CTGTTGGAGGCTTGGTGTTGGGG - Intergenic
935821997 2:106902692-106902714 CTTTGGAATGCTTGCAGATTGGG - Intergenic
935824870 2:106935813-106935835 TTGTGGCAGACTTTGTGATTTGG + Intergenic
936731467 2:115386048-115386070 CTGTGGAATAATTGGTGTTTAGG + Intronic
936915303 2:117633904-117633926 TTGAGGAAGGCATGGTGACTAGG - Intergenic
937436673 2:121887253-121887275 GTTTGAAAGGCTGGGTGATTTGG - Intergenic
939326914 2:140703672-140703694 CTGTGGACTACTTGGGGATTGGG - Intronic
940372739 2:152921073-152921095 CCGTGGAAGGCATGGTGCTATGG - Intergenic
941071454 2:160959397-160959419 ATTTGGAAGGCTTGGTCATCAGG + Intergenic
944482925 2:200175526-200175548 CTGTGGAAGGTTTGTTCTTTTGG + Intergenic
944721320 2:202425613-202425635 CTGTGGAGGAGTTGGTGAGTGGG + Intronic
945885781 2:215374115-215374137 CTGAGGACTGCTTGGTTATTAGG - Intronic
946339702 2:219059507-219059529 CGGTGGAAGGGTGGGTTATTGGG - Intronic
946630055 2:221657222-221657244 CTTTGGAAGGAAGGGTGATTTGG + Intergenic
947271232 2:228337861-228337883 CTGTGTCAGCCTTGGTGAGTGGG - Intergenic
947553686 2:231068038-231068060 CTGAGGAAGGCATGGGTATTGGG - Intronic
947665741 2:231904368-231904390 CTGTGGAAGGGGTGGCGATAAGG + Intergenic
1169166541 20:3429197-3429219 ATGTTGAAGGCGTGGTGACTGGG + Intergenic
1170733367 20:18992819-18992841 GTCTGGAAGGCTTGGAGGTTAGG - Intergenic
1177405416 21:20661405-20661427 CGGTGGAATGCCTGGTCATTGGG - Intergenic
1177555561 21:22683412-22683434 CTTTGGAACTCTTGGTGAGTAGG + Intergenic
1179177780 21:39021496-39021518 CTGAGGAAGGCTGGGTGGGTGGG + Intergenic
1182115086 22:27751850-27751872 CTGGGGAGCGCTTGGGGATTGGG - Intronic
950454359 3:13083957-13083979 CTGGGGAAGGCTAGGGGATGGGG - Intergenic
951181794 3:19668050-19668072 CTGTGGAATGGTTGGTGAGTTGG - Intergenic
951312860 3:21150529-21150551 CTGTGGAAGGGTGGGGGACTAGG - Intergenic
953642641 3:44723824-44723846 TTCTGGAATGCTTGGTTATTTGG + Exonic
953655067 3:44844790-44844812 CCCTGGAATGCTTGGTGTTTGGG - Intronic
956332837 3:68130431-68130453 CTGTGGAAGCCTGGGAGGTTTGG - Intronic
959620305 3:108392697-108392719 CTGTGGGAGGCTTGGAGGCTGGG + Intronic
960076810 3:113495551-113495573 CTGGGGAAGGGTTGTTGACTGGG - Intronic
961090809 3:124111137-124111159 TAGTGGCAGGCTGGGTGATTAGG - Intronic
961282395 3:125774314-125774336 CTGTGGAAGGATAGGGGCTTTGG - Intergenic
962852598 3:139319072-139319094 CTGGGGAAGGCTGGAGGATTTGG + Intronic
963241448 3:143006966-143006988 CTGTGGATAGCTTGGTAATTTGG + Intronic
963773492 3:149414725-149414747 CTGTGGAAGGCAAGGAGAATGGG + Intergenic
963957893 3:151275580-151275602 CTGTGGTAAACTTGGTGTTTCGG + Intronic
963977850 3:151502705-151502727 TTTTGGCAGGCTTGGTTATTTGG + Intergenic
964768229 3:160198577-160198599 CTGTGGAAGCTCTGGTGAATGGG - Intergenic
965827117 3:172742519-172742541 CTGTGGCAGCCTTGGTGTTGTGG + Intergenic
967455456 3:189680954-189680976 CTGGTGAAGGCCTGGTGTTTGGG + Intronic
967989095 3:195118242-195118264 CTTGGGAAGGCTTGGAGATTTGG - Intronic
969567782 4:7989965-7989987 CTGTGGCAGGCTTGGCTATTAGG + Intronic
974020384 4:56687731-56687753 CTGGGGAAGGCCAGGTGGTTGGG - Intergenic
974235110 4:59171047-59171069 CTCAGGAAGGTTTTGTGATTTGG + Intergenic
974743298 4:66036271-66036293 CTGTGAAAAGCATGGTGATCAGG + Intergenic
975392140 4:73832968-73832990 CTGAGGAAGGCTGGGTGGTTTGG - Intergenic
977586458 4:98780308-98780330 CTGTGGGAGGCATGGTTATCTGG + Intergenic
978574705 4:110177597-110177619 GTGTGGGAAGCTTGGTGATATGG + Intronic
979575023 4:122279958-122279980 CTGTAGAAGGCTGTCTGATTAGG - Exonic
982944689 4:161605283-161605305 CTGTGGAAGGCTATGTGCTATGG - Intronic
987101621 5:14596262-14596284 CTGTGGAAGGCTTGGTGATTGGG - Intronic
989251434 5:39319887-39319909 CTGGGGAAGGCCTGGAGCTTGGG - Intronic
989431676 5:41362382-41362404 CTGTGCAAGGCTAGGTGAGTTGG + Intronic
990328254 5:54699189-54699211 CTGTGAAAGGCATGGTGATCAGG - Intergenic
990932039 5:61103176-61103198 CTATGCAAGGCTTCCTGATTTGG + Intronic
992459936 5:76951533-76951555 CTGTGGCATGCCTGGTGAGTGGG + Intergenic
992844885 5:80736496-80736518 CTAAGGAAAGCTTTGTGATTAGG - Intronic
992897079 5:81254691-81254713 CTAGGGAAGGGTTGGTCATTGGG + Intronic
992913468 5:81422430-81422452 CTGAGGAAAGGTGGGTGATTAGG + Intronic
993077229 5:83248411-83248433 CTGTGGAAGTATTGGAGATGCGG + Intronic
997395121 5:133553536-133553558 CTTTGAAAGGATTTGTGATTTGG - Intronic
1000531798 5:162431238-162431260 TTGGGGTAGGCTTCGTGATTAGG - Intergenic
1000663290 5:163962964-163962986 CTGTGGAAGGCTTGAAGAAAGGG + Intergenic
1001327097 5:170736999-170737021 CTGGGGAAGGCTTGGGGGCTGGG - Intergenic
1003950411 6:11110789-11110811 CTCTGGAGGACTTGGTGTTTGGG + Intronic
1004364103 6:14997580-14997602 CAGTGGAAGAGTTGGTGATAAGG - Intergenic
1004882627 6:20023749-20023771 CTGTGGAAGGGTTGTTCTTTTGG + Intergenic
1007425555 6:41743870-41743892 CTGCTGAAGCCTTGGTGTTTGGG - Intronic
1008483445 6:52009928-52009950 CTGAGGACGGCTGAGTGATTTGG + Intronic
1008680485 6:53866587-53866609 CTGTGGAAGGCCTCATTATTTGG + Intronic
1010257335 6:73774239-73774261 CTTTGGAAGTCTAGCTGATTTGG + Intronic
1015829141 6:137348808-137348830 CTGTGGAGGGGTTGGTTATTAGG - Intergenic
1018671757 6:166183991-166184013 CTTTGAAAGGGTTTGTGATTGGG - Intergenic
1018971264 6:168531059-168531081 CTGTGGGAGGATTTGTGGTTGGG - Intronic
1019216679 6:170448352-170448374 CTGTGGAAAGCCTGGTGGTGAGG + Intergenic
1019438078 7:1031962-1031984 CTGGGGAAGGTTTGGTGACCAGG - Intronic
1020086554 7:5313591-5313613 GTGTGGCAGGCATGGTGATGAGG + Exonic
1022349107 7:29550196-29550218 CAGTGGCAGGCTAGGTTATTTGG + Intergenic
1023201178 7:37698525-37698547 CTGTGGAAGGATTTGGGTTTTGG + Intronic
1025207759 7:57003547-57003569 GTGTGGCAGGCATGGTGATGAGG - Intergenic
1025664177 7:63573325-63573347 GTGTGGCAGGCATGGTGATGAGG + Intergenic
1026255061 7:68704001-68704023 ATGGGGAAGGCTTGGTAACTGGG - Intergenic
1026873333 7:73866441-73866463 CTGTGGATGGCTTTGTGAGTGGG - Intergenic
1029074006 7:97921742-97921764 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1033156528 7:138961541-138961563 CTGTGAAAGGATTGTTGAGTGGG - Intronic
1033873006 7:145780204-145780226 CTGTGGCAGGCTTGCAGATCAGG + Intergenic
1037163720 8:15801586-15801608 CTGTGGATGGCTGGGTAAATTGG + Intergenic
1037229569 8:16640060-16640082 CTGTGGTAGGCTGGGTGATGTGG - Intergenic
1038724078 8:30064093-30064115 GTGTAGTAGGCTTGATGATTGGG - Intronic
1040602272 8:48896869-48896891 CTCTGGATGGCTTTTTGATTCGG + Intergenic
1041187513 8:55316244-55316266 ATGTGGAAGATTTGGTGTTTTGG - Intronic
1043070367 8:75629480-75629502 CTGTGAAAGGATTTGTGAATAGG - Intergenic
1044819649 8:96147033-96147055 CTGGGGAAGGCTGGGGGCTTTGG - Intronic
1046125222 8:109898546-109898568 CTGGGGAAGGCTTAGTGGTCTGG + Intergenic
1046387116 8:113519624-113519646 CTCTGGAAGACTTGGGGCTTGGG - Intergenic
1053352521 9:37422920-37422942 CTGGGGCAGGCTTGGAGTTTTGG + Intronic
1056502448 9:87223291-87223313 CTGTGGGAGGCTTGGAAATGGGG + Intergenic
1058569543 9:106325912-106325934 CTGTGGAAAGCTTCTTCATTTGG - Intergenic
1058743944 9:107971447-107971469 CTGGGAGAGGCTTGGAGATTTGG + Intergenic
1060058684 9:120439262-120439284 CTGGGGAAGGCTTGATGGTGGGG - Intronic
1061659017 9:132115875-132115897 CTGTGGATGCCTTGCTGACTTGG - Intergenic
1185915491 X:4029891-4029913 ATGTGGAAGGATTCATGATTTGG + Intergenic
1189316072 X:40057446-40057468 CTGTGGATGTCTTGGTGAGGGGG + Intronic
1193534038 X:82691050-82691072 CTGTGGTAGGCCTGGAGCTTTGG + Intergenic
1193618687 X:83723537-83723559 CTGTGGCAGGTTTGGTAAATGGG + Intergenic
1194434057 X:93848698-93848720 CAGTGGTAGGCTAGGTGAATGGG + Intergenic
1195613916 X:106897758-106897780 CTGTGAAATGCTGGGTGCTTAGG + Intronic
1197555667 X:127949456-127949478 CTGTGGATGACTTTGAGATTGGG - Intergenic
1197913913 X:131514366-131514388 CTGTGGAGTGCTTGGTGACTAGG - Intergenic
1198341944 X:135723164-135723186 CTCTGGAAGGCTATTTGATTCGG - Exonic
1198346050 X:135760199-135760221 CTCTGGAAGGCTATTTGATTCGG + Exonic
1198347954 X:135777483-135777505 CTCTGGAAGGCCAGTTGATTCGG + Intergenic
1198349860 X:135794745-135794767 CTCTGGAAGGCCAGTTGATTCGG + Exonic
1198351764 X:135812021-135812043 CTCTGGAAGGCCAGTTGATTCGG + Exonic
1198353674 X:135829287-135829309 CTCTGGAAGGCCAGTTGATTCGG + Exonic
1198355580 X:135846539-135846561 CTCTGGAAGGCCAGTTGATTCGG + Exonic
1198357491 X:135863818-135863840 CTCTGGAAGGCCAGTTGATTCGG + Intergenic
1198359401 X:135881105-135881127 CTCTGGAAGGCCAGTTGATTCGG + Exonic
1199129340 X:144165835-144165857 CTGTTGGAGGCTTGGTGTTGGGG + Intergenic