ID: 987101915

View in Genome Browser
Species Human (GRCh38)
Location 5:14598365-14598387
Sequence GAGAAATCACACCAGTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987101911_987101915 -1 Left 987101911 5:14598343-14598365 CCTTGTAAATGGAGCCTAAAGTG No data
Right 987101915 5:14598365-14598387 GAGAAATCACACCAGTACTGGGG 0: 1
1: 0
2: 0
3: 10
4: 130
987101909_987101915 21 Left 987101909 5:14598321-14598343 CCAGTATGTACAGGAGAGCTTTC 0: 1
1: 0
2: 0
3: 14
4: 81
Right 987101915 5:14598365-14598387 GAGAAATCACACCAGTACTGGGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987101915 Original CRISPR GAGAAATCACACCAGTACTG GGG Intronic