ID: 987108373

View in Genome Browser
Species Human (GRCh38)
Location 5:14662975-14662997
Sequence ATTGAATCCAGAATCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987108371_987108373 -8 Left 987108371 5:14662960-14662982 CCTCTGAGATAAAACATTGAATC No data
Right 987108373 5:14662975-14662997 ATTGAATCCAGAATCTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987108373 Original CRISPR ATTGAATCCAGAATCTCTGG TGG Intergenic
No off target data available for this crispr