ID: 987108418

View in Genome Browser
Species Human (GRCh38)
Location 5:14663305-14663327
Sequence AAATGTGCACAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987108418_987108422 0 Left 987108418 5:14663305-14663327 CCTTCTTCCCTCTGTGCACATTT No data
Right 987108422 5:14663328-14663350 ATCTATGTGTCCCCTTCTAAGGG No data
987108418_987108427 21 Left 987108418 5:14663305-14663327 CCTTCTTCCCTCTGTGCACATTT No data
Right 987108427 5:14663349-14663371 GGCGCCAACCATTCGATTTAGGG No data
987108418_987108421 -1 Left 987108418 5:14663305-14663327 CCTTCTTCCCTCTGTGCACATTT No data
Right 987108421 5:14663327-14663349 TATCTATGTGTCCCCTTCTAAGG No data
987108418_987108426 20 Left 987108418 5:14663305-14663327 CCTTCTTCCCTCTGTGCACATTT No data
Right 987108426 5:14663348-14663370 GGGCGCCAACCATTCGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987108418 Original CRISPR AAATGTGCACAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr