ID: 987108697

View in Genome Browser
Species Human (GRCh38)
Location 5:14664867-14664889
Sequence CGCGAGCTGCGCCGAGACGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987108695_987108697 -7 Left 987108695 5:14664851-14664873 CCGAAGCGTGGCCAGGCGCGAGC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54
987108694_987108697 -6 Left 987108694 5:14664850-14664872 CCCGAAGCGTGGCCAGGCGCGAG 0: 1
1: 0
2: 0
3: 2
4: 71
Right 987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54
987108693_987108697 -2 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 987108693 5:14664846-14664868 CCAGCCCGAAGCGTGGCCAGGCG 0: 1
1: 0
2: 0
3: 8
4: 69
Right 987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54
987108692_987108697 -1 Left 987108692 5:14664845-14664867 CCCAGCCCGAAGCGTGGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54
987108690_987108697 0 Left 987108690 5:14664844-14664866 CCCCAGCCCGAAGCGTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54
987108688_987108697 22 Left 987108688 5:14664822-14664844 CCGCATGAGTCGGGGGACTATGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987108697 Original CRISPR CGCGAGCTGCGCCGAGACGC CGG Exonic
912517071 1:110223185-110223207 CGTGTGCTGCCCCGACACGCTGG + Exonic
912793518 1:112675342-112675364 CGCGAGCGGCGCATGGACGCGGG - Intronic
916676349 1:167066881-167066903 CGCGTGCTGCCCCGAGGCGCGGG + Intronic
1077916162 11:6612644-6612666 CGCCAGCTGCCCCGAGAGGTGGG + Exonic
1083470508 11:62880988-62881010 CGCAAGCTGCGTCGTGTCGCCGG + Intronic
1097990324 12:65825848-65825870 CGCGAGCAGCCCCGGGAGGCGGG - Intronic
1113437944 13:110307541-110307563 CCCGAGCGGCGCCCAGACCCTGG + Intronic
1115257760 14:31420659-31420681 CGCGCCCTGCGCCGGGCCGCTGG + Intronic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1122542780 14:102507267-102507289 CGCCAGCTGGGCCGCGACGCCGG - Exonic
1122557994 14:102591957-102591979 CGCGAGCTGCGTGGGGACTCGGG - Intergenic
1122688907 14:103522500-103522522 GGCGGGCTGCGGGGAGACGCGGG + Exonic
1129116417 15:73367785-73367807 TGCGGGCTGCGCCGAGGCGCCGG + Exonic
1132806448 16:1777287-1777309 CGCCAGCTGCGGCCAGACTCGGG - Exonic
1132869443 16:2109280-2109302 CGTGAGCTGGGCCCAGGCGCAGG - Exonic
1134717969 16:16366319-16366341 CGTGAGCTGGGCCCAGGCGCAGG + Intergenic
1134956782 16:18385840-18385862 CGTGAGCTGGGCCCAGGCGCAGG - Intergenic
1136655988 16:31709500-31709522 CTGGAGCTGCTCCAAGACGCTGG - Intergenic
1138507686 16:57486365-57486387 CGCCAGCCGCGCCGTGACGCGGG - Exonic
1146208023 17:30921828-30921850 CCCGAGCTCCGCCGACGCGCGGG - Exonic
1146398686 17:32487381-32487403 GGCGGGGTGCGCCGAGGCGCGGG + Intronic
1149595356 17:57861886-57861908 CGCGCGCGGGGCCGGGACGCTGG - Exonic
1149626500 17:58083868-58083890 CCCGGGCTGCGCCGAGAGGGAGG - Intronic
1157248238 18:46072019-46072041 CGCGAGCTCCGCCAAGCCCCCGG + Intronic
1158678368 18:59543537-59543559 CGCGAGAGGCCCCGAGAGGCCGG + Intronic
1160164093 18:76495253-76495275 CGCCAGCTGCGCCCGGGCGCGGG + Intergenic
1160768887 19:821716-821738 CGCGTGCTGGGCCGGGGCGCGGG - Intronic
924991641 2:317629-317651 GGCGAGCTGTGCAGAGCCGCTGG - Intergenic
930641704 2:53859950-53859972 CGGGAGCCGCGGCAAGACGCGGG + Exonic
948922718 2:241073269-241073291 CTCGAGCTGCGCCGAGGCTGTGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1178431292 21:32520688-32520710 GGGGAGCAGCGCCGAGACCCAGG - Intergenic
1179297751 21:40078717-40078739 TGCGGGCTGCGCGGAGAAGCAGG - Exonic
1179532049 21:42026315-42026337 AGCGAGCTGGGCTGAGACACAGG - Intergenic
1179882786 21:44300408-44300430 CGCGGGCGGCGCCAAGACCCAGG - Intronic
1183677683 22:39308969-39308991 CGCCTGCAGCGCGGAGACGCTGG - Intergenic
954540624 3:51391241-51391263 CGGGAGCGGCGCCGAGGGGCCGG - Intergenic
966592113 3:181695351-181695373 CGTGGGCTGCTCCGAGGCGCAGG - Intergenic
975541294 4:75514599-75514621 CGGCAGCGGCGCGGAGACGCTGG + Exonic
981550519 4:145937493-145937515 CGGGAGCTGCGCCGAGGCGAAGG - Intronic
983398498 4:167233928-167233950 CGCGCGCTGCTCCGAGGCGGGGG - Intronic
987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG + Exonic
990545527 5:56816630-56816652 CGCGGGCTGGGCCCGGACGCAGG + Intronic
999223590 5:150001194-150001216 CGAGGGCCGCGCCGAGCCGCTGG + Intronic
1005059976 6:21766840-21766862 CGCAAGGTGCTCCGAGATGCCGG - Intergenic
1006309703 6:33249114-33249136 CGCGAGCTCACCCCAGACGCCGG - Intergenic
1007784212 6:44270807-44270829 CGTGAGCTCCTCCGAGACCCCGG - Exonic
1011054746 6:83193344-83193366 CGCGACCTGCGGCGAGGCGGGGG - Intronic
1011633846 6:89352634-89352656 CCCGAGCCGCGCTGAGACCCGGG - Exonic
1014632485 6:123803704-123803726 CGCGGGCTGCGCAGGGAGGCGGG + Intergenic
1014725084 6:124963071-124963093 CGAGAGCTGCTCCGAGGCGGGGG - Exonic
1019032388 6:169024396-169024418 CCCGGGCAGCCCCGAGACGCCGG - Intergenic
1021452744 7:20797968-20797990 CGGGAGGTGCGCAGAGGCGCGGG - Intergenic
1022942987 7:35257431-35257453 CGAGAGCAGAGCCGAGACGGCGG + Intergenic
1049569074 8:143359943-143359965 CGAGGCCTGCGCGGAGACGCCGG + Intronic
1049707335 8:144049018-144049040 CGCGAGCTGCGGGGAGTCACAGG - Intergenic
1053312116 9:37026745-37026767 CCGGAGCTGCGCGGAGAGGCGGG + Intronic
1058153584 9:101487158-101487180 CGCGAGCTGCGGAGAGACCGCGG + Intronic
1192561693 X:72131727-72131749 CGCGCCCTGGGCCGAGCCGCCGG - Exonic
1200228659 X:154433078-154433100 TGCCAGCTGCCCCGAGAAGCAGG - Intronic