ID: 987108711

View in Genome Browser
Species Human (GRCh38)
Location 5:14664905-14664927
Sequence CTTCCCGCCGTCCCGCGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987108711_987108720 20 Left 987108711 5:14664905-14664927 CCACGGCGCGGGACGGCGGGAAG 0: 1
1: 0
2: 2
3: 8
4: 80
Right 987108720 5:14664948-14664970 GCGGCCCGAGATGCAGTGCCCGG 0: 1
1: 0
2: 1
3: 4
4: 94
987108711_987108716 -8 Left 987108711 5:14664905-14664927 CCACGGCGCGGGACGGCGGGAAG 0: 1
1: 0
2: 2
3: 8
4: 80
Right 987108716 5:14664920-14664942 GCGGGAAGGCGGCGGCCAGCGGG 0: 1
1: 0
2: 3
3: 22
4: 290
987108711_987108715 -9 Left 987108711 5:14664905-14664927 CCACGGCGCGGGACGGCGGGAAG 0: 1
1: 0
2: 2
3: 8
4: 80
Right 987108715 5:14664919-14664941 GGCGGGAAGGCGGCGGCCAGCGG 0: 1
1: 0
2: 4
3: 32
4: 395
987108711_987108717 1 Left 987108711 5:14664905-14664927 CCACGGCGCGGGACGGCGGGAAG 0: 1
1: 0
2: 2
3: 8
4: 80
Right 987108717 5:14664929-14664951 CGGCGGCCAGCGGGCAGCCGCGG 0: 1
1: 0
2: 1
3: 36
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987108711 Original CRISPR CTTCCCGCCGTCCCGCGCCG TGG (reversed) Exonic