ID: 987112180

View in Genome Browser
Species Human (GRCh38)
Location 5:14698745-14698767
Sequence CATTGTGAGCAGAGGAATCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987112172_987112180 14 Left 987112172 5:14698708-14698730 CCTATGATGTCCACATGGCTGAC 0: 1
1: 0
2: 0
3: 20
4: 160
Right 987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG 0: 1
1: 0
2: 2
3: 19
4: 248
987112169_987112180 27 Left 987112169 5:14698695-14698717 CCCGCAAGGCAGACCTATGATGT 0: 1
1: 0
2: 0
3: 12
4: 83
Right 987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG 0: 1
1: 0
2: 2
3: 19
4: 248
987112173_987112180 4 Left 987112173 5:14698718-14698740 CCACATGGCTGACTCTTGACCCC 0: 1
1: 0
2: 0
3: 30
4: 168
Right 987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG 0: 1
1: 0
2: 2
3: 19
4: 248
987112170_987112180 26 Left 987112170 5:14698696-14698718 CCGCAAGGCAGACCTATGATGTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG 0: 1
1: 0
2: 2
3: 19
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987112180 Original CRISPR CATTGTGAGCAGAGGAATCA AGG Exonic
900211971 1:1460613-1460635 GCTTGTGAGCACAGGAAACATGG - Intronic
900217628 1:1490120-1490142 GCTTGTGAGCACAGGAAACATGG - Intronic
901254021 1:7805412-7805434 CATGGTGAGAAGAGGTCTCAAGG + Intronic
902336476 1:15757770-15757792 CATTGTGGGGAAAGGAATCTGGG - Intronic
903300780 1:22377147-22377169 CACTGTGGTTAGAGGAATCAGGG - Intergenic
903337971 1:22637528-22637550 CATTGTGTGCATGGGACTCAAGG + Intronic
904797394 1:33067242-33067264 CCTTTTGAGCAGAGGCATAAGGG - Intronic
906091729 1:43185335-43185357 CCGTGAGAGCAGAGAAATCAGGG + Exonic
906258738 1:44369954-44369976 CATTTTGAGTAGAGAAAGCAAGG - Intergenic
906610933 1:47202003-47202025 CATTGTGGGGAGAGGGAGCATGG + Intergenic
906900153 1:49826779-49826801 CATTGTAAGAAAAGAAATCATGG + Intronic
907650374 1:56289015-56289037 TATTGTGAATAGAAGAATCAGGG + Intergenic
909416329 1:75409966-75409988 AAATGTGAGCTGAGGAATCCTGG - Intronic
916640277 1:166720741-166720763 CATTGTGAAAAGAGAAAGCATGG - Intergenic
916822553 1:168413761-168413783 CAATGTGATCATAGGAAACAGGG + Intergenic
918086602 1:181250762-181250784 CCTTCTGAGCAGAGGTATAAGGG - Intergenic
920149064 1:203889056-203889078 CATTGTTAAGACAGGAATCAGGG + Intergenic
920630755 1:207649228-207649250 TATTCAGAGCAGAGGAAGCAAGG + Intronic
920641534 1:207756160-207756182 TATTCAGAGCAGAGGAAGCAAGG + Intronic
920724278 1:208419273-208419295 CAGTATGATCATAGGAATCATGG - Intergenic
922661360 1:227433183-227433205 CAGTGGGAGCAGAGCAATCTGGG - Intergenic
922973306 1:229761244-229761266 CAGACTGAGCAGAGGAAGCAGGG - Intergenic
923814515 1:237360835-237360857 CATTTTTAGCAGGGGAATCCTGG + Intronic
923972517 1:239220142-239220164 CATTGAGAGCAAAGCAGTCAAGG + Intergenic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
1066254740 10:33667466-33667488 CAGTAAGAGCAAAGGAATCAAGG + Intergenic
1067148078 10:43708087-43708109 CATTGTAAGCATAAGAATCAGGG - Intergenic
1068396633 10:56470342-56470364 CATTTTCAGCAGAAGAATCATGG + Intergenic
1071153802 10:82666662-82666684 CATGGTGGGAAGAGGATTCAAGG - Intronic
1073377110 10:103045257-103045279 CATTTTGAGCAGAGGAGACGAGG - Intronic
1073964685 10:108975781-108975803 TATTTTTAGAAGAGGAATCACGG - Intergenic
1077619051 11:3702735-3702757 CATTGTGAACACAGAAGTCAGGG + Exonic
1077655989 11:4019228-4019250 CATTTTAATGAGAGGAATCAAGG - Intronic
1077782083 11:5341905-5341927 AAATGTGAGAAGAGGAATCACGG - Intronic
1077908038 11:6548818-6548840 CCTGCTGAGCAGAGGAATCCAGG + Exonic
1078254970 11:9650912-9650934 CATTTTGAGCGGTGGAATCTTGG + Intergenic
1078663613 11:13306606-13306628 CATTCTGGGCAGAGGAATTCTGG + Intronic
1078839615 11:15066276-15066298 CCTTTTGAGCAGAGGTATAAGGG + Intronic
1081231706 11:40592528-40592550 CCTTGTGGGAAGAGGACTCAAGG + Intronic
1081726541 11:45333797-45333819 CTTTCTGGGCACAGGAATCACGG - Intergenic
1081778102 11:45690870-45690892 CATTCTTAGCAGAAGCATCAAGG + Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085367732 11:75966983-75967005 CTTTCTGACCAGAGGAACCAGGG - Intronic
1085480287 11:76816538-76816560 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1085873509 11:80379253-80379275 GACTGTGAGCAGAAGAGTCATGG + Intergenic
1086736410 11:90311348-90311370 CATTTTTAGGAGAGGAAGCAAGG + Intergenic
1089396920 11:118142187-118142209 CACTGGGAGCAGAGGAGTTAGGG - Intronic
1090760847 11:129835727-129835749 CATTTAGGGTAGAGGAATCAGGG + Intronic
1093346688 12:18045717-18045739 TATTTTGGGCAGAGGACTCACGG + Intergenic
1093735474 12:22615284-22615306 CATTGTGAAAAGAGAAAGCATGG - Intergenic
1094100251 12:26753914-26753936 CATTGTGACAAGAGAAAGCATGG - Intronic
1095602554 12:44029927-44029949 CATTGTGAAAAGAGAAAGCATGG - Intronic
1095781821 12:46068376-46068398 CAAAGTGAGCAGGGGAAGCAGGG - Intergenic
1098196173 12:68004391-68004413 CATTGGGAAGAGAGGAATCTGGG - Intergenic
1099001880 12:77187852-77187874 CAATGGGAGCAGAGGAAGCCTGG - Intergenic
1099048687 12:77756438-77756460 TATTGTGAACATAGGAATGAAGG + Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1102707421 12:114894302-114894324 CATTGTGAGCATATGATTAATGG + Intergenic
1102993339 12:117330397-117330419 CAGTGGGAGCAGAGGGGTCAAGG - Exonic
1103742910 12:123103492-123103514 CTTTGTGAGCTGAGGATTCTTGG - Intronic
1104074360 12:125376576-125376598 CATTCTGAGATGAGGAAACAAGG - Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1106763596 13:32891975-32891997 CATTGGGAGCAGGGGAATTGTGG + Intergenic
1108179704 13:47828668-47828690 CCTGTTGAGCAGAAGAATCATGG - Intergenic
1108231529 13:48348497-48348519 CACTGTGAGCAGAAAAATGAAGG - Intronic
1108507994 13:51129941-51129963 CATTGTGAAAAGAGAAAGCAAGG - Intergenic
1108725718 13:53178726-53178748 CAATGAGAGCAAAGGAAACACGG + Intergenic
1111679914 13:91429638-91429660 CACTGTGATCAGAGGATTCCAGG + Intronic
1112528763 13:100180442-100180464 CATTGTGGGAAGAGGAATCTTGG - Intronic
1114029051 14:18559343-18559365 CAGTAAGAGGAGAGGAATCAAGG + Intergenic
1115156157 14:30341379-30341401 AATTCTGAGCAGAGGAGTCCAGG - Intergenic
1116789209 14:49321782-49321804 CATTTTGAAAAGAGGAGTCAAGG + Intergenic
1118322064 14:64759169-64759191 CATTGTGTGGATAGGAAGCAGGG - Intronic
1122410369 14:101522679-101522701 CAATGTGAGCAGTGGAGTCTGGG + Intergenic
1123155797 14:106224675-106224697 CATGGTGAGCAGGGGAAAGAAGG + Intergenic
1125898137 15:43319857-43319879 CATTGTGAGTAAAGGAATGGAGG + Intergenic
1128230634 15:66032435-66032457 CATTGTGAACAGAGCATTAAGGG + Intronic
1128510273 15:68309920-68309942 CATTATTAGCTGAGGAATAATGG + Intronic
1128606501 15:69040100-69040122 CATCGTGAGCTGAGGGATCTGGG - Intronic
1129700950 15:77768497-77768519 CATTGTGAGGAGAGCCATGAAGG + Intronic
1129703072 15:77779053-77779075 CATTCAAAGCAGAGGAAACAGGG - Intronic
1130379364 15:83358510-83358532 CCTAGTTAGCAAAGGAATCAGGG + Intergenic
1131448433 15:92518882-92518904 TATTATGAGCAAAGGAATGATGG + Intergenic
1131670650 15:94616135-94616157 TATTCTAAGCAGAGGAATGAAGG + Intergenic
1132407675 15:101553957-101553979 CATTGTGGGAAGTGGAATCATGG - Intergenic
1132656897 16:1045180-1045202 CATTCTGAGCAGAGCAATCCAGG - Intergenic
1133617457 16:7491411-7491433 CATTGTGAGCAGAAGCAGCCTGG + Intronic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1137902445 16:52283491-52283513 CACTGTGTGGAGAGAAATCAGGG + Intergenic
1138160446 16:54748288-54748310 CTTTGGGAACAGAGGAATTATGG - Intergenic
1141364695 16:83431944-83431966 GATTTTGAGCAGAGGAAAGAGGG + Intronic
1142034049 16:87852912-87852934 CCTCGTGAGCAGAGGAGTGAAGG - Intronic
1144166507 17:12616524-12616546 CACTGGGAGCAGAGGATTCTGGG - Intergenic
1146608625 17:34285347-34285369 CCATGTGAACACAGGAATCAAGG + Intergenic
1150980594 17:70137423-70137445 CATTCAGAACAGAAGAATCAAGG - Intergenic
1151287538 17:73123849-73123871 CATTGTGCCCACAGGAAGCAGGG - Intergenic
1151658220 17:75505580-75505602 CATTGAGAGCAGTGGGATCGTGG + Exonic
1152381984 17:79946893-79946915 CATTGTGAGCAGAGGACGCTGGG - Intronic
1153545910 18:6204429-6204451 GATTGTGACCAGAGGAATCATGG - Intronic
1157304394 18:46506656-46506678 CATTGTGAGAATAGGAAGAAAGG + Intronic
1157507301 18:48237318-48237340 CATTGTGAGGAGAAGAATGGAGG + Intronic
1158516370 18:58133837-58133859 CTTTCTGAGCTTAGGAATCATGG + Intronic
1159221205 18:65465296-65465318 AATTGTGAGAAGAAGATTCAAGG + Intergenic
1159998537 18:74992546-74992568 CATGGTGAGCTGAGGATTCGTGG + Intronic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1167673317 19:50868995-50869017 CATTGTCTGCAGAGAAATTATGG + Intronic
1167773973 19:51542868-51542890 CATACTGAGCAGAGCAATCCTGG + Intergenic
925043870 2:755930-755952 CATCCTCAGCAGAGGGATCAGGG + Intergenic
926043999 2:9696229-9696251 CATTCTGAGCTAAGGAATCTTGG - Intergenic
928328173 2:30336537-30336559 CAATGTCTTCAGAGGAATCAGGG - Intergenic
930112352 2:47689332-47689354 CAATGTGTGCAGAGGAAGCGGGG + Intergenic
931600027 2:63993880-63993902 CCTTTTGAGCAGAGGTATAAGGG - Intronic
931643687 2:64403175-64403197 CATTGAGAGCCCAAGAATCATGG - Intergenic
932029769 2:68171810-68171832 GATTGTGAGCAGAGGAAGGGAGG + Intronic
934586774 2:95506753-95506775 CACTGTGTGCAGTGGAATCCTGG - Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
936531914 2:113282465-113282487 CATTGTGCCCAGAGAAACCAGGG - Intergenic
939569053 2:143818691-143818713 AAATGGGAGCAGAGGAGTCAAGG - Intergenic
941531351 2:166675171-166675193 CATTGTGAAAAGAGAAATCAAGG + Intergenic
941639551 2:167972471-167972493 CATTGTGAAAAGAGAAAGCAAGG - Intronic
941704415 2:168642562-168642584 CAATGTTAACAGAGTAATCAGGG + Intronic
948398033 2:237661874-237661896 CATTTTGTCCAAAGGAATCATGG - Intronic
1172801914 20:37581827-37581849 CATTCAGAGCTGAGGAATCTGGG - Intergenic
1172933991 20:38606332-38606354 CATTTTCAGAATAGGAATCATGG + Intronic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173942332 20:46921929-46921951 TACTGTGATCAGAGGAAGCAGGG - Intronic
1174753157 20:53132261-53132283 CAGTGGGAGCAGGGGATTCAAGG - Intronic
1177216725 21:18139591-18139613 CACTGTGTGCAGTGGAATCCTGG + Intronic
1177407559 21:20690241-20690263 CATTTTGAGCAAAGCAAACAGGG + Intergenic
1178201792 21:30415233-30415255 CATTGTGAAAAGAGAAAGCATGG - Intronic
1178437108 21:32569687-32569709 CCTGGTGTGCAGAGGAATCGTGG - Intergenic
1178551481 21:33543180-33543202 CGTTGGGAGCAGAAGAATCTGGG - Intronic
1179189431 21:39110067-39110089 CATTGTGAGCACCAGAAGCATGG - Intergenic
1179559064 21:42201320-42201342 TATTGTGAGCTGAGCACTCAAGG - Intronic
1180453169 22:15486405-15486427 CAGTAAGAGGAGAGGAATCAAGG + Intergenic
1183253285 22:36744917-36744939 CTTTGTGAGCAAATGAATAAAGG + Intergenic
1183777457 22:39976013-39976035 CATTGTCAGCAGAGGATGCGTGG - Intergenic
949397101 3:3626306-3626328 CATTGTGAACAGAGAAAGTAAGG - Intergenic
950134149 3:10568788-10568810 CATTCTGAGCAGTGGAAACCAGG - Intronic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
953416239 3:42719731-42719753 CATTGTGAAAAGAGAAAGCATGG - Intronic
954528419 3:51295277-51295299 CAGTGTGTGCAGAGATATCATGG + Intronic
955146688 3:56326819-56326841 CACAGAGAGCAGAGGAATGATGG - Intronic
955995599 3:64677434-64677456 CATTGGGTACAGAGGAAACAAGG + Intronic
957353803 3:79057215-79057237 CCTTTTGAGCAGAGGTATAAGGG - Intronic
958596800 3:96236353-96236375 CTTTATGAGAAGAGGAATTAAGG + Intergenic
960396950 3:117149394-117149416 CATAGTGTGCAGTGGAATGAAGG + Intergenic
960658328 3:120030516-120030538 GATTGTGAGCAAGGGAATAATGG - Intronic
961510766 3:127401987-127402009 CATTGTGAAAAGAGAAAGCATGG + Intergenic
961755203 3:129122766-129122788 CCTTGTGAGGAGAGGACCCAGGG + Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962603169 3:137010743-137010765 CCTTGAGAGAAAAGGAATCATGG + Exonic
963923712 3:150929499-150929521 CATAGTAAGTAAAGGAATCAGGG - Intronic
964696616 3:159515224-159515246 GATTGTGAGCAGAGGAGTTCTGG - Intronic
964913964 3:161816981-161817003 CATTGAAAGCAGATGATTCATGG + Intergenic
967097442 3:186188514-186188536 CACTGTCAGAAGAGAAATCATGG + Intronic
969634658 4:8360124-8360146 CATTGTGAAAAGAGAAAGCATGG - Intergenic
969889290 4:10244742-10244764 CAATGAAATCAGAGGAATCAAGG - Intergenic
970058323 4:12000470-12000492 CATTTTTAGGAGAGGAGTCAAGG - Intergenic
970875178 4:20861009-20861031 CTTTGTGAGCAGTGGAACCGAGG - Intronic
972059273 4:34848005-34848027 CTTTGTGAGAGGAGGCATCATGG - Intergenic
972631815 4:40848675-40848697 AATTGTAAGCAGAGGAGTCATGG - Intronic
974605543 4:64145675-64145697 CCTTTTGAGCAGAGGAATAAGGG + Intergenic
976755025 4:88488977-88488999 CTCAGTGAGCAGAGGAAACAAGG - Intronic
977162287 4:93650072-93650094 AAGTGTGAGCCTAGGAATCAAGG - Intronic
978557727 4:109998708-109998730 CATAGTGAGAAGAGGCAGCATGG - Intronic
980778511 4:137466150-137466172 CATTGTGAAAAGAGAAAGCATGG - Intergenic
981485865 4:145285383-145285405 CATTGTGGGCAGGGGAATTTAGG + Intergenic
981552152 4:145952888-145952910 CTATGTGACCAGAGGAGTCAGGG - Intergenic
981656644 4:147119377-147119399 CATTGTCTGCTGAGGAATAATGG + Intergenic
984087960 4:175335403-175335425 TAAGGTGACCAGAGGAATCAGGG - Intergenic
985390529 4:189487870-189487892 CATGGTGAGAAGACGAAACATGG - Intergenic
986643228 5:9892092-9892114 GATTGTGGGGAGAGGAATAAAGG - Intergenic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
987534861 5:19171849-19171871 CATTCTGAGGGGAGGAATTATGG - Intergenic
989465292 5:41747842-41747864 CAGTGTGGGCAGAGGTGTCAGGG - Intronic
993939502 5:94041375-94041397 CATTGTGAAAAGAGAAAGCACGG - Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
998414630 5:141937243-141937265 CTTGGTGTGCAGAGGAATCTGGG + Exonic
1000897993 5:166879441-166879463 CATTCTGGGCAGAGAAAACAAGG + Intergenic
1001521774 5:172399346-172399368 CCTTTTGAGCAGAGGTATAAGGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001566475 5:172702685-172702707 GATTTTAAGCAGAGGAATGATGG - Intergenic
1008333357 6:50269774-50269796 AATTATGTTCAGAGGAATCATGG - Intergenic
1008559202 6:52706440-52706462 CATTGTGAAAAGAGAAACCATGG - Intergenic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1008945622 6:57093730-57093752 CATTTTGAGTAGAAGAAACAAGG + Intronic
1010732117 6:79402298-79402320 CATTGGGAGAAGAGGAAGAAAGG + Intergenic
1012342023 6:98138717-98138739 CATTGTAAACAGAGATATCATGG - Intergenic
1014111627 6:117624111-117624133 CATTGTGAAAAGAGAAAGCACGG - Intergenic
1014384472 6:120783720-120783742 CATTGTGAGTTGAGGAATCATGG - Intergenic
1014946964 6:127510360-127510382 GAGTGTGAGCAAAAGAATCAAGG + Intronic
1015291730 6:131545286-131545308 CATTCTGAGCTAAGGAATCTGGG + Intergenic
1015308113 6:131733316-131733338 AATTGAGAGCAGAGGAATAATGG - Intronic
1017850509 6:158301228-158301250 CCTTTTGAGCAGAGGTATAAGGG + Intronic
1018066406 6:160127599-160127621 GTTTGGGAGCAGAGGAAGCATGG + Intronic
1018357467 6:163033730-163033752 CATTGTGAAAAGAGAAAGCATGG + Intronic
1018936682 6:168278368-168278390 CATTGAGAAGAGTGGAATCAGGG - Intergenic
1021405192 7:20259064-20259086 TATGGTGAGCAGAGGAAGCTAGG - Intergenic
1021495885 7:21274263-21274285 CTTTGTGAGCACAGGGACCACGG - Intergenic
1021601063 7:22363934-22363956 CATTCTCAGCAGAGGCAGCACGG - Intergenic
1021858771 7:24884610-24884632 TTTTGTGAGCAGAGGAGTCCCGG - Intronic
1022253261 7:28629695-28629717 CATTGGGAACATATGAATCATGG - Intronic
1023659903 7:42460685-42460707 CATTGTCAGAAGAGGAATGATGG - Intergenic
1027474835 7:78616305-78616327 TATTGAAAGCAGAGAAATCAAGG + Intronic
1028389064 7:90294547-90294569 CATTGTGAAAAGAGAAAGCATGG + Intronic
1029464541 7:100716930-100716952 CAAGGTGAGCAGAGGATGCAGGG + Intergenic
1030547801 7:110919705-110919727 CATTGTGAGCTAAGGCATTAGGG + Intronic
1033161744 7:139002900-139002922 CATTGTGAAAAGAGAAAGCATGG - Intergenic
1035427490 7:158790114-158790136 CATTGTCATCAGTGGAATAAAGG - Intronic
1036419952 8:8586200-8586222 AGTTTTGAGCAGAGGAATCATGG - Intergenic
1037520380 8:19675162-19675184 AGTTGTGAGCAGAGGAAGAATGG - Intronic
1039309897 8:36305931-36305953 CATTGTCAGCTGTGGCATCAGGG + Intergenic
1040010996 8:42661142-42661164 GATTGTGGGGAGAGGAATCAGGG + Intergenic
1040400222 8:47043189-47043211 CATTGTCAGCAGAGGGATAGAGG - Intergenic
1040514509 8:48123895-48123917 CCTTGGGAGCAGAGAGATCACGG - Intergenic
1041211418 8:55555038-55555060 CACTGTGATAAGAGGAATCAAGG + Intergenic
1042213101 8:66401162-66401184 CATCATGAGCAGATGAATAAAGG + Intergenic
1043005914 8:74818335-74818357 CATAGTGAGCAGATGAGTTATGG - Intronic
1044142563 8:88673227-88673249 CCTTTTGAGCAGAGGTATAATGG + Intergenic
1044439610 8:92208209-92208231 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1045259198 8:100557552-100557574 GGTTTTGAGCAGAGGAATGAGGG - Intronic
1045428246 8:102088196-102088218 CATTGTGAAAAGAGAAAGCATGG - Intronic
1045819407 8:106318494-106318516 CTTTGTGAACATAGGAAGCAGGG - Intronic
1046816134 8:118585852-118585874 CACTGTGAGCAGAGAAAACAAGG - Intronic
1047945291 8:129870542-129870564 CAATGTCAGAAGAGAAATCAAGG + Intronic
1050401636 9:5262284-5262306 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1050474944 9:6031398-6031420 GATTTTGAGGAGAGGACTCAGGG - Intergenic
1050937429 9:11415405-11415427 CATTGTGAACAGGTGACTCAAGG - Intergenic
1051538992 9:18193412-18193434 CATTGCTAGCAGAGGCACCATGG - Intergenic
1052891581 9:33705195-33705217 CATTGTGAAAAGAGAAAACATGG - Intergenic
1052898452 9:33769775-33769797 CATTTAGGGTAGAGGAATCAGGG + Intronic
1053416317 9:37949016-37949038 CAGTGTGAGGACAGGCATCATGG + Intronic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053581045 9:39404364-39404386 AATTGTGACCAGAGCAATAATGG - Intergenic
1053845537 9:42232421-42232443 AATTGTGACCAGAGCAATAATGG - Intergenic
1054102632 9:60963168-60963190 AATTGTGACCAGAGCAATAATGG - Intergenic
1054583729 9:66943698-66943720 AATTGTGACCAGAGCAATAATGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1059357235 9:113709449-113709471 AACTGTCAGCAGGGGAATCAAGG + Intergenic
1059563820 9:115362653-115362675 CTTTATGTGCAGAAGAATCAAGG + Intronic
1061465683 9:130777567-130777589 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465692 9:130777643-130777665 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465701 9:130777719-130777741 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465708 9:130777795-130777817 GACTGTGAGCAGAGGAATCGAGG + Intronic
1061465717 9:130777871-130777893 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465726 9:130777947-130777969 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465735 9:130778023-130778045 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465744 9:130778099-130778121 GACTGTGAGCAGGGGAATCGAGG + Intronic
1061465751 9:130778175-130778197 GACTGTGAGCAGAGGAATCGAGG + Intronic
1061465760 9:130778251-130778273 GACTGTGAGCAGGGGAATCGAGG + Intronic
1186638837 X:11433595-11433617 GATTATGATCAGAGGAATGAAGG - Intronic
1188133869 X:26470634-26470656 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1188136626 X:26500814-26500836 CATTATGATCTGAGGAATCCTGG + Intergenic
1188531437 X:31145609-31145631 AATTGTAAGAAGAGGAATGAAGG - Intronic
1188823255 X:34800131-34800153 CCTTTTGAGCAGAGGTATAAGGG - Intergenic
1189557930 X:42164643-42164665 CCTTTTGAGCAGAGGTATAAGGG + Intergenic
1189781484 X:44518189-44518211 CACTGTGATCAGTGGAATGATGG - Intergenic
1189858923 X:45252307-45252329 CATTTTCAGGAGAGGAATCTAGG - Intergenic
1190904278 X:54710679-54710701 TAGATTGAGCAGAGGAATCAGGG - Intergenic
1190947515 X:55110068-55110090 CATTGTGAAAAGAGAAAGCATGG - Intronic
1191125080 X:56945920-56945942 CCTTTTGAGCAGAGGTATAAGGG - Intergenic
1193363984 X:80608565-80608587 AGTTGTGAGCAAAGTAATCAAGG - Intergenic
1193635413 X:83944090-83944112 CACTGTGAGCAGATGCAACAAGG + Intergenic
1197358650 X:125469593-125469615 CATTCTGAGCTGCGGAAGCATGG + Intergenic
1201254075 Y:12089777-12089799 CATTGTGGTCAGATGAATAATGG - Intergenic
1202247083 Y:22830941-22830963 CCTTTTGAGCAGAGGTATAAAGG + Intergenic
1202400072 Y:24464689-24464711 CCTTTTGAGCAGAGGTATAAAGG + Intergenic
1202470709 Y:25205397-25205419 CCTTTTGAGCAGAGGTATAAAGG - Intergenic