ID: 987114084

View in Genome Browser
Species Human (GRCh38)
Location 5:14712954-14712976
Sequence CAGGGTGCACGGTGCGACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987114084_987114087 -5 Left 987114084 5:14712954-14712976 CCAGGGTCGCACCGTGCACCCTG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 987114087 5:14712972-14712994 CCCTGCAGATGAGAACACAAAGG 0: 1
1: 0
2: 2
3: 36
4: 299
987114084_987114090 23 Left 987114084 5:14712954-14712976 CCAGGGTCGCACCGTGCACCCTG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 987114090 5:14713000-14713022 TGTCTGTTAAGGCCAAGTCAAGG 0: 1
1: 0
2: 1
3: 5
4: 124
987114084_987114089 12 Left 987114084 5:14712954-14712976 CCAGGGTCGCACCGTGCACCCTG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 987114089 5:14712989-14713011 CAAAGGCAATTTGTCTGTTAAGG 0: 1
1: 0
2: 1
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987114084 Original CRISPR CAGGGTGCACGGTGCGACCC TGG (reversed) Exonic
901767750 1:11514722-11514744 CAGGGTAGAGGGTGTGACCCGGG - Intronic
909395864 1:75169921-75169943 CAGGCTTCATGGTGCTACCCTGG + Intergenic
912642151 1:111357374-111357396 CAGGGTGCACGGAGACAGCCAGG - Intergenic
913213882 1:116603834-116603856 CTGGCTGCACGGTGCCATCCCGG + Exonic
917656370 1:177130273-177130295 CAGGGTGGTCCGTGTGACCCTGG + Intronic
1062795081 10:338935-338957 CAGGGTGCATTGTGGGAGCCAGG - Intronic
1062864670 10:841739-841761 CAGGGAGCACGGCGCCATCCTGG + Intronic
1062981219 10:1724599-1724621 CAGAGAGCACAGTGGGACCCTGG - Intronic
1076688106 10:132207257-132207279 CACGGTGCACGGTGCTGTCCTGG + Intergenic
1077051719 11:569552-569574 CAGGGGGCAGGCTGCGGCCCAGG - Intergenic
1082057262 11:47829354-47829376 CAGGCTGGATGGTGCGATCCCGG + Intronic
1083445983 11:62708292-62708314 CAGGATGAAAGGTGAGACCCCGG + Exonic
1084791805 11:71479771-71479793 CAGGGGGCACTGTGGGACACAGG - Intronic
1084935508 11:72584532-72584554 CAGGGTGCGCGTGGCGGCCCGGG - Exonic
1088884017 11:113993140-113993162 CAGGGTGCACAGTGTGGCCCGGG - Intergenic
1090658272 11:128862051-128862073 CAAGATGAGCGGTGCGACCCAGG - Intronic
1090931044 11:131298245-131298267 CAAGGTGCACAGTGCACCCCTGG + Intergenic
1094738709 12:33264153-33264175 CAGTGTGCAAGGTGCCATCCTGG + Intergenic
1096669668 12:53191159-53191181 CGGGGTGCACCCTGGGACCCAGG - Exonic
1103912521 12:124360233-124360255 CAGGGTACAGTGTGCGGCCCAGG - Intronic
1105217110 13:18294385-18294407 CTGGCTGCACGGTGCCATCCCGG + Intergenic
1108575013 13:51783033-51783055 CGGGGTGCACGGCGCGGCCCAGG + Intronic
1113602226 13:111578083-111578105 CAGGGTGCACGCTGTGTCCCAGG + Intergenic
1113893434 13:113748625-113748647 CAGGCTTCACGGTGTGGCCCTGG - Intergenic
1113923489 13:113927796-113927818 CAAGGTCCACAGAGCGACCCTGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118019598 14:61696300-61696322 CAGCGTGCAGGGTCCGCCCCAGG - Intronic
1121244680 14:92453241-92453263 GAGGGTGCACGGTGAGCCGCTGG - Intronic
1122959136 14:105086669-105086691 CAGGGTGCAGGGTGAGGCACAGG + Intergenic
1124631188 15:31338605-31338627 CAGGATGGAGGGTGGGACCCTGG + Intronic
1129256000 15:74334457-74334479 CAGGGTTCAGTGTGCGACCAGGG + Intronic
1129689380 15:77704850-77704872 CAGGGTTCAGGGTGGGACCAGGG - Intronic
1130550732 15:84888680-84888702 CGGGGGCCACGGTGAGACCCTGG - Intronic
1131686411 15:94772742-94772764 CAGGGTGCAAGGTGAGAACCAGG - Intergenic
1132294477 15:100725435-100725457 CAGTGTGCACAGGGAGACCCCGG + Intergenic
1132486454 16:194612-194634 CAGGGTGCTGGGTGCTACGCTGG + Intronic
1132715920 16:1289734-1289756 CAGGATGCAAGGAGCGGCCCCGG + Intergenic
1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG + Intronic
1133126074 16:3646829-3646851 CAGGGTGCATGGTGCGGGCGGGG + Intronic
1135074720 16:19383364-19383386 GAGGGTGCACGGAGGGAGCCGGG - Intergenic
1139573521 16:67827631-67827653 CATGGTGCACAGGGAGACCCAGG - Intronic
1140494119 16:75368051-75368073 CAGAGGGCACGGTGCGATCTTGG - Intronic
1141819057 16:86432518-86432540 CAGGGTGCACGGTGTGGCGGAGG - Intergenic
1141969656 16:87472407-87472429 CTCGGTGCACGGTGCCAGCCTGG - Intronic
1145915943 17:28574076-28574098 CTGGGGGCACAGTGCGACGCAGG + Exonic
1146494694 17:33311144-33311166 CTGTGTGCAAGGTGCCACCCTGG + Intronic
1148155337 17:45421454-45421476 CAGGGTCTACTGTGCCACCCAGG - Intronic
1148899873 17:50867118-50867140 CAGGCCTCCCGGTGCGACCCCGG + Intronic
1152512805 17:80801913-80801935 CAGGGCGCACGGTGCTGCACGGG + Intronic
1152924185 17:83079988-83080010 GAGTGTGCGCGGCGCGACCCCGG + Intronic
1156411004 18:36828592-36828614 CGGGGTGAGCGGTGCGACGCTGG - Intronic
1158532897 18:58279398-58279420 CAGGATGAAAGGTGCGACCAAGG + Intronic
1161028331 19:2046763-2046785 CAGTGTGGACGCTGCGACACTGG - Intronic
1161406543 19:4094400-4094422 GAGGGTGCAGGCTGCCACCCAGG - Intronic
1162474136 19:10889725-10889747 CAGGGTCCACGGTTGGATCCGGG - Intronic
1163662991 19:18589536-18589558 CACAGTGCACGGGGTGACCCAGG + Exonic
1167358442 19:49017659-49017681 CAGGATGCCCGGAGCGTCCCCGG + Intergenic
925008992 2:468025-468047 CAAGGTGCAGTGTGCGCCCCTGG - Intergenic
926134237 2:10325484-10325506 CAGGGAGAACAGTGCCACCCTGG - Intronic
928327956 2:30334999-30335021 CAGGTGGCACTGTGGGACCCAGG - Intergenic
934297214 2:91752297-91752319 CTGGCTGCACGGTGCCATCCCGG - Intergenic
934745608 2:96757640-96757662 CTGGGTGCACCGTGGGCCCCGGG - Intergenic
936275256 2:111090634-111090656 CAGGATGCATGGTGTGAGCCTGG + Intronic
936454116 2:112658093-112658115 CCGAGTGCACGGTGGGAACCAGG + Intronic
937220244 2:120338936-120338958 CAGGGAGCATGGTGTGAACCAGG + Intergenic
937271451 2:120655367-120655389 AAGGCTGCATGGTGCCACCCTGG - Intergenic
937361249 2:121231581-121231603 CTGGGTGCCCGGTGGGAGCCAGG - Intronic
946865597 2:224039069-224039091 CAGGCTGCGCGGTGAGTCCCGGG - Intronic
948631085 2:239303097-239303119 CAGGGTTCAGGGTGGGCCCCTGG + Intronic
949010090 2:241673313-241673335 CAGAGTGCACTCTGGGACCCGGG - Exonic
1169060011 20:2654320-2654342 CAGCGTGCTCGGTGGGACCAGGG + Intronic
1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG + Intronic
1169889068 20:10433712-10433734 GAGGGTGCACGGTGTACCCCAGG - Intronic
1170683498 20:18547678-18547700 CAGGGTGCACTGTCAGTCCCCGG + Intronic
1171133192 20:22674032-22674054 CAGAGGGCAGGGTGGGACCCAGG + Intergenic
1175780645 20:61680086-61680108 CAGGATGCAGGGTGCAGCCCTGG - Intronic
1176042732 20:63073769-63073791 CAGGGTGCACAAGGCCACCCAGG - Intergenic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1179631343 21:42680415-42680437 CAGGGTGGACACTGTGACCCTGG + Intronic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1180702504 22:17789315-17789337 GAGGGTGCAAGGTGGGACCCTGG - Exonic
1183305068 22:37078406-37078428 CCGGGTACACGGTGAGGCCCTGG - Intronic
954881259 3:53837496-53837518 CAGGCCGCACCGTGTGACCCAGG + Intronic
955005690 3:54966272-54966294 CAGGGTGCAGGGTGCAAAACAGG - Intronic
961047832 3:123721624-123721646 CAGTGTGCACGCTGTGACCCAGG + Intronic
961270125 3:125681940-125681962 CAGTGTGCACTCTGTGACCCAGG - Intergenic
962655690 3:137542249-137542271 CAGGGTGCAGGGTGAGTCCATGG + Intergenic
962702184 3:138010442-138010464 CGGGGTGCACGGTGCCTACCTGG - Exonic
968967970 4:3778922-3778944 CAGGGTGCCTGGTGCTAGCCAGG + Intergenic
969378988 4:6782429-6782451 CAAGCTGCACGGCGCGTCCCGGG + Intronic
969620348 4:8275711-8275733 AAGGGTGAACGGTGTGACACTGG + Intronic
972803629 4:42504824-42504846 CAGGGTGGACGGGGCCTCCCAGG - Intronic
977665850 4:99646557-99646579 CAGGGAGCAAGGTGTGGCCCAGG + Intronic
980973209 4:139586324-139586346 CTGGGTGAAGGGTGTGACCCTGG - Intronic
984208145 4:176812355-176812377 CAGGGTTCACTGTGTCACCCAGG - Intergenic
987114084 5:14712954-14712976 CAGGGTGCACGGTGCGACCCTGG - Exonic
987242907 5:16019210-16019232 CACTGTGCACTGTGCAACCCAGG + Intergenic
991166264 5:63567617-63567639 CAGGTTGCTGGGTGGGACCCCGG - Intergenic
992374402 5:76174247-76174269 CGGGGAGCACGGGGCGACGCTGG - Intronic
998149095 5:139746901-139746923 TTGGGAGCAGGGTGCGACCCTGG - Intergenic
998160168 5:139808735-139808757 CTGGGTGGGCGGTGCCACCCGGG - Intronic
1008091167 6:47295135-47295157 CAGGGTGAATGCTGAGACCCAGG - Intronic
1017712262 6:157181334-157181356 CAGGGAGCACTGGGGGACCCTGG + Intronic
1019312465 7:369446-369468 CAGGGTGCGTGGTGGGACCCAGG - Intergenic
1020107369 7:5428312-5428334 CAGGGTGCGCGGCGTGGCCCGGG - Intergenic
1026360571 7:69598501-69598523 GAGGGTGCACGGCGTGTCCCCGG - Intergenic
1034270102 7:149799607-149799629 CAGGTGGCACGGTGAGGCCCAGG + Intergenic
1034286201 7:149884857-149884879 TAGGGTGCAGTGTGAGACCCAGG - Intergenic
1034555562 7:151848326-151848348 CAGTGTGCAAGGTGCCACCTTGG + Intronic
1034560792 7:151877956-151877978 GAGGGTTCCCGGTGCGGCCCAGG + Intergenic
1037802976 8:22045070-22045092 CATCCTGCAAGGTGCGACCCGGG - Intronic
1049216272 8:141409788-141409810 CAGGATGCACCATGTGACCCAGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049572361 8:143375238-143375260 CAGGCTGCCTGGTGAGACCCTGG + Intronic
1053436765 9:38080742-38080764 CAGAGTGCATGGTGCGATCTTGG - Intergenic
1055341026 9:75283350-75283372 CAGGGTGCACGGTGAGAGGAGGG - Intergenic
1055506856 9:76956819-76956841 CAGGGTCCAAGGTGTGACCACGG + Intergenic
1062645212 9:137544301-137544323 CAGCATGCAGGGTGTGACCCAGG - Intronic
1197870397 X:131058277-131058299 CTGGGTGCAGGGTGCGGCTCAGG + Exonic