ID: 987115209

View in Genome Browser
Species Human (GRCh38)
Location 5:14721025-14721047
Sequence CCTTTGGAGCAGTGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987115199_987115209 1 Left 987115199 5:14721001-14721023 CCCATCTTGTAGAAGATCAGAAA 0: 1
1: 1
2: 0
3: 10
4: 234
Right 987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 354
987115198_987115209 14 Left 987115198 5:14720988-14721010 CCAGAGGCGTTTTCCCATCTTGT 0: 1
1: 0
2: 0
3: 2
4: 105
Right 987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 354
987115200_987115209 0 Left 987115200 5:14721002-14721024 CCATCTTGTAGAAGATCAGAAAA 0: 1
1: 0
2: 4
3: 23
4: 308
Right 987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 354
987115197_987115209 15 Left 987115197 5:14720987-14721009 CCCAGAGGCGTTTTCCCATCTTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987115209 Original CRISPR CCTTTGGAGCAGTGGGTGGG GGG Intronic
900479989 1:2893314-2893336 CCTGTGGGGCAGTGGGTGAGGGG + Intergenic
900803912 1:4755068-4755090 CCCATGGAGCCGTGGTTGGGTGG + Intronic
900985892 1:6072654-6072676 CTGTTGGGGGAGTGGGTGGGGGG + Intronic
901231790 1:7645739-7645761 CCTCTGCAGCACTGGGCGGGCGG + Intronic
901242201 1:7702052-7702074 CCTGTGGTGCAGTGAGTGGCAGG + Intronic
901602676 1:10434019-10434041 ACCTGGGAGCAGTGCGTGGGTGG + Intronic
901623383 1:10607229-10607251 CCTTTTTACCATTGGGTGGGTGG + Intronic
901690099 1:10967259-10967281 TGTTTGGAGCAGAGGGAGGGAGG - Intronic
901987131 1:13084962-13084984 GCTCTGGAGCAGTGGGTGTCTGG - Intergenic
901994681 1:13141805-13141827 GCTCTGGAGCAGTGGGTGTCTGG + Intergenic
902961969 1:19970207-19970229 GCCTTGGAGCAGTGGATTGGTGG + Intergenic
903728787 1:25473977-25473999 GCTCTGGAGCAGAGTGTGGGGGG - Intronic
904287718 1:29462727-29462749 CCTTGTGAGTAGTGGGTAGGAGG + Intergenic
905403034 1:37716861-37716883 CCTCTGGGTCAGTGGGTAGGTGG - Exonic
907490331 1:54805303-54805325 GCTGTGGAGCACTGGTTGGGGGG + Intergenic
908959718 1:69681763-69681785 GGTTTGGAGGAGTGAGTGGGAGG - Intronic
910464286 1:87480549-87480571 CCTCTGGAGCAGTGGGCAGTGGG + Intergenic
910842665 1:91575656-91575678 AATTTGCAGCAGTGGCTGGGGGG + Intergenic
911377580 1:97069744-97069766 CTTTGGGGGCAGTGGGGGGGGGG + Intergenic
911721108 1:101192159-101192181 AATTTGAAGCAGAGGGTGGGTGG + Intergenic
912734813 1:112141353-112141375 AGATTGGAGCTGTGGGTGGGTGG + Intergenic
913017341 1:114752470-114752492 CACTTGGAGCAGGGGTTGGGGGG - Intronic
913403854 1:118465784-118465806 TCTTTGTAGCAGTGGGTGAACGG + Intergenic
915073759 1:153292938-153292960 CCTCTGGGGCTGTGGGTGGTGGG - Intergenic
915307541 1:154989319-154989341 CCTCTGTAGCAGGGGGTGTGGGG - Intronic
915333141 1:155126028-155126050 CCCTGGGAGCAGTCGGCGGGTGG + Intergenic
915461917 1:156075579-156075601 TCTTTGGAGGAGTGGGGGAGAGG + Exonic
915786360 1:158617234-158617256 CTTTGGGAACAGTGGGTGGGTGG - Intronic
915807751 1:158872432-158872454 CCTGTTGTGCAGTGGGGGGGAGG + Intergenic
916811188 1:168307105-168307127 GCTTTGGAGCAGAGTGTAGGGGG + Intronic
917670602 1:177270066-177270088 ACTTTGGGGCAAGGGGTGGGGGG + Intronic
918217720 1:182407538-182407560 CCTTTGGGGCAGTGGGTCTAGGG + Intergenic
922790918 1:228310562-228310584 CGGATGGATCAGTGGGTGGGTGG - Intronic
922791152 1:228311813-228311835 CCATCTGAGAAGTGGGTGGGAGG + Intronic
923091029 1:230741449-230741471 CCTGTGGAGCAGCGAGTGTGGGG + Intergenic
924268607 1:242308921-242308943 GATTTGGAGGAGTGTGTGGGAGG + Intronic
1062827310 10:582143-582165 TTTTTGTAGCAGGGGGTGGGTGG - Intronic
1065213326 10:23425438-23425460 TCTTTAGAGCAGTGTGAGGGTGG - Intergenic
1065841245 10:29703338-29703360 TCTCTGGAGCAGTGGGGGGCTGG - Intronic
1065892562 10:30133648-30133670 CCTTTGGAGCCGTGGCAGTGTGG - Intergenic
1066174446 10:32888868-32888890 ACTTTGGATCAGTGGGTGTGGGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066716298 10:38289847-38289869 GATTTGGAGGAGTGTGTGGGAGG - Intergenic
1067008689 10:42690544-42690566 ACTTTGGAGCAGTAGGTAGGAGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1068548812 10:58384056-58384078 CCTTTGGGGCTGGGGGCGGGGGG + Intergenic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069846144 10:71373019-71373041 ACTGGGGAGCAGTGGGTGAGGGG + Intergenic
1070443485 10:76469519-76469541 TCTCTGGAGCAGTGGCTTGGAGG + Intronic
1071495003 10:86162184-86162206 CTTTTGGGGCTTTGGGTGGGTGG + Intronic
1072693493 10:97586732-97586754 CCTCTGCAAGAGTGGGTGGGTGG - Intronic
1072785469 10:98276935-98276957 TGACTGGAGCAGTGGGTGGGGGG - Intergenic
1073147699 10:101291622-101291644 CCTTTGGGGCAGGAGTTGGGGGG + Intergenic
1073185434 10:101612743-101612765 CCTGAGGAGGAGTGGCTGGGTGG - Intronic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1074925124 10:118060885-118060907 TCCTTGGAGTAGTGGGTGTGGGG - Intergenic
1075001559 10:118802484-118802506 CCTTTGGAAGAGTGGGGAGGAGG + Intergenic
1075095522 10:119468514-119468536 ACTTGGGAGCTGGGGGTGGGGGG - Intergenic
1075273134 10:121070379-121070401 TCTATGGACCTGTGGGTGGGGGG - Intergenic
1075644635 10:124089634-124089656 ATTTCAGAGCAGTGGGTGGGAGG - Intronic
1076617450 10:131765342-131765364 CCTATGCTGCAGTGGGTAGGAGG - Intergenic
1076672700 10:132131841-132131863 CCCATGGGGCTGTGGGTGGGGGG - Intronic
1077213524 11:1384360-1384382 CCTTTGGGTGGGTGGGTGGGTGG - Intergenic
1077313353 11:1903310-1903332 GCTGTGGAGCGGGGGGTGGGGGG + Intergenic
1077358816 11:2130779-2130801 CGGTTGGAGGGGTGGGTGGGGGG - Intronic
1078886093 11:15501370-15501392 TCTTTGGAACAGGAGGTGGGAGG - Intergenic
1079137825 11:17786212-17786234 CCTTTAGGACAGTGGGTGGTGGG + Intergenic
1081655451 11:44854184-44854206 TCATTGGGGCAGGGGGTGGGGGG + Intronic
1081757352 11:45554170-45554192 CATATGGAGGAGGGGGTGGGAGG + Intergenic
1081806711 11:45894830-45894852 CCTTTGGAGCAGCCAGGGGGTGG + Intronic
1082788067 11:57328248-57328270 TGTGTGGTGCAGTGGGTGGGGGG - Intronic
1083947405 11:65931942-65931964 CCTTTGGAGAACAGGGAGGGAGG + Intergenic
1084065922 11:66704545-66704567 CCTTGGGAGGTGGGGGTGGGGGG - Intronic
1084120707 11:67067327-67067349 CCCTGGCAGCAGTGGGTGAGGGG - Intronic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1084380814 11:68811535-68811557 CTTCTGGGGCAGGGGGTGGGGGG + Intronic
1084803566 11:71563747-71563769 CCTGTGGGGTAGTGAGTGGGGGG + Intronic
1084967694 11:72752906-72752928 CCTTGGGAGGTGTGGCTGGGTGG - Intronic
1085033707 11:73287829-73287851 CTCCTGGAGCACTGGGTGGGAGG + Intronic
1085506855 11:77065938-77065960 GCTTTGCTGCACTGGGTGGGCGG + Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1088364896 11:109030461-109030483 CCTTTTGTGGAGTGGGGGGGAGG - Intergenic
1089028287 11:115294789-115294811 CCTTGGGAGGAGGAGGTGGGTGG + Intronic
1091700080 12:2653455-2653477 CCTGTGGAGGAGTGGGGTGGTGG - Intronic
1091846447 12:3659739-3659761 ACTCTGGAGCTGTGGGTGTGGGG + Intronic
1091950779 12:4591304-4591326 CCTTTGGGGCAGTAGCAGGGTGG + Intronic
1092654676 12:10672479-10672501 CTTTAGGAGGAGTTGGTGGGTGG - Intronic
1092926419 12:13276300-13276322 CCTTTTGGGAAGTGGGTGGGTGG + Intergenic
1093947342 12:25124767-25124789 ACTTAGGAGTAGAGGGTGGGAGG - Intronic
1096252597 12:50042547-50042569 CCATTGGAGCAGAGGGTTGGAGG + Intergenic
1100073639 12:90752637-90752659 CATTTGAAGCAGTGTGTAGGTGG - Intergenic
1100179214 12:92065861-92065883 CTTTTAGAGCAGTGAGGGGGAGG + Intronic
1102480554 12:113220679-113220701 ACATGGGAGCTGTGGGTGGGAGG - Intronic
1102864967 12:116367214-116367236 CCTTGGGAGCTGTGAGTGAGAGG + Intergenic
1104198783 12:126567310-126567332 ACTGTGGGGCAGGGGGTGGGTGG - Intergenic
1104540056 12:129655675-129655697 ACTTTGTTGCAGTGGCTGGGAGG - Intronic
1104803151 12:131568511-131568533 TGTTTGGATGAGTGGGTGGGTGG - Intergenic
1108352040 13:49596618-49596640 CTTGTCGAGCAGAGGGTGGGGGG + Intergenic
1108642525 13:52395923-52395945 ACTTGGGTGCAGTGGGTGGCTGG + Intronic
1110730899 13:78877341-78877363 GGTTTGGAGCTGTGGCTGGGTGG + Intergenic
1112537568 13:100275040-100275062 CCCTTGGGGGAGGGGGTGGGGGG + Intronic
1112960009 13:105112597-105112619 CCTTTGGACAAGTGGGGGGGGGG - Intergenic
1113286313 13:108852664-108852686 CCCTTGGAGCTGTTGGCGGGAGG - Intronic
1114129718 14:19776506-19776528 GCTTAGGAGAAGTAGGTGGGTGG + Intronic
1117438204 14:55737600-55737622 CCTTTGGAGAAGAGCCTGGGTGG - Intergenic
1120701921 14:87707432-87707454 CCTTTGCTGTGGTGGGTGGGGGG - Intergenic
1120730085 14:87992499-87992521 CTTTTGGAGGAGTTGGTGGGTGG - Intronic
1121260999 14:92566063-92566085 CCTTTGAGGCACTGGGTTGGTGG + Intronic
1121324878 14:93014022-93014044 CCTTTGGAGAAAAGGGTGCGGGG - Intronic
1121845883 14:97171680-97171702 CATTTAAAGCAGTGTGTGGGAGG - Intergenic
1121871364 14:97410937-97410959 CCTTTGCAGGAATGGGTGGATGG + Intergenic
1122488010 14:102094673-102094695 CCTTCAGTGCAGTGGGTAGGGGG + Intronic
1122789669 14:104178957-104178979 CCCCTTGGGCAGTGGGTGGGTGG + Intronic
1122893539 14:104744067-104744089 CATTGGCATCAGTGGGTGGGTGG + Intronic
1122896537 14:104760324-104760346 TGTTTGGGGCAGAGGGTGGGTGG + Intronic
1122898121 14:104770470-104770492 CTACTGGAGCTGTGGGTGGGTGG - Intronic
1123126083 14:105947159-105947181 CGTTTGGATGTGTGGGTGGGTGG - Intergenic
1123126102 14:105947251-105947273 CGTTTGGATGTGTGGGTGGGTGG - Intergenic
1123126121 14:105947343-105947365 CGTTTGGATGTGTGGGTGGGTGG - Intergenic
1123126159 14:105947527-105947549 CGTTTGGATGTGTGGGTGGGTGG - Intergenic
1123425162 15:20164688-20164710 CCTCTGGGGGAGTGGGTGGTGGG + Intergenic
1123534387 15:21171221-21171243 CCTCTGGGGGAGTGGGTGGTGGG + Intergenic
1123572998 15:21634234-21634256 GCTTAGGAGGAGTAGGTGGGTGG + Intergenic
1123609617 15:22076819-22076841 GCTTAGGAGGAGTAGGTGGGTGG + Intergenic
1123981839 15:25612057-25612079 CCACTGGAGCAGAGGGTGGGAGG - Intergenic
1124028035 15:25984900-25984922 CACTTGAAGCAGTGGATGGGAGG - Intergenic
1126525531 15:49650152-49650174 AGTTTGGAACAGTGTGTGGGAGG + Exonic
1127288998 15:57553937-57553959 CTTTTGGCGCAGTGTGTGGTGGG + Intergenic
1127394965 15:58537302-58537324 ACTTTGGAGGGGTGGGTGAGTGG - Intronic
1128322484 15:66703229-66703251 CCTTTGGCGCCAGGGGTGGGGGG - Exonic
1129327227 15:74807161-74807183 TCCTTAGAGCAGGGGGTGGGTGG + Intergenic
1129331716 15:74831317-74831339 CCTGTGAAGCTGTAGGTGGGGGG - Exonic
1129776608 15:78241136-78241158 CCTGTGGAGACCTGGGTGGGTGG - Intronic
1129884206 15:79027213-79027235 CCTTGGGAGCAGTGTTTGAGAGG - Intronic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1202981859 15_KI270727v1_random:368603-368625 GCTTAGGAGGAGTAGGTGGGTGG + Intergenic
1132549345 16:547967-547989 CAGTCGGGGCAGTGGGTGGGGGG - Exonic
1132590424 16:724041-724063 AGTGTGGGGCAGTGGGTGGGTGG + Intronic
1132786151 16:1658002-1658024 TGTGTGGAGCAGTGGGTGTGTGG - Intronic
1133018543 16:2955828-2955850 CCCGTGGAGGAGGGGGTGGGCGG + Intergenic
1133155504 16:3872456-3872478 CCTTGGGAGCAGTGCCTGTGGGG - Intronic
1134490759 16:14693938-14693960 CCCTGGGAGGAGTGAGTGGGGGG + Intronic
1134496140 16:14733056-14733078 CCCTGGGAGGAGTGAGTGGGGGG + Intronic
1134656244 16:15949996-15950018 CCTGCGGAGCAGAGCGTGGGGGG + Intronic
1134661646 16:15988821-15988843 CTTTGGGAGCCCTGGGTGGGAGG + Intronic
1136154664 16:28374774-28374796 CCCTGGGAGGAGTGAGTGGGGGG - Intergenic
1136264516 16:29107160-29107182 CCCTGGGAGGAGTGAGTGGGGGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139541347 16:67619574-67619596 TTTTTGGAGCAGGGGGTGCGTGG + Intronic
1141056197 16:80816937-80816959 CCTTGGGGACAGTGGGTAGGAGG - Intergenic
1142202068 16:88765915-88765937 CCTTGGGAGGCCTGGGTGGGCGG - Intronic
1142432678 16:90038710-90038732 CCTTTGCAGAAGTGACTGGGTGG + Intronic
1142903305 17:3026623-3026645 CCCTGGGCGCAGTGGGTGAGGGG + Intronic
1143197492 17:5087319-5087341 CTTTGGGAGGAGTAGGTGGGAGG - Intronic
1144013473 17:11172022-11172044 CCTTTGGACTCATGGGTGGGAGG - Intergenic
1144440992 17:15281509-15281531 GCTTTGGTGCAGAGGGTGGGGGG - Intergenic
1144774646 17:17779206-17779228 CCTCTGGAGCAGTGGCTGGCTGG + Intronic
1144884244 17:18448103-18448125 CCCTTGGAGCAGGGGGAGGAAGG + Intergenic
1145147987 17:20496274-20496296 CCCTCGGAGCAGTGGGAGGAAGG - Intergenic
1145796532 17:27658762-27658784 CTTTTGGAGCAGCAGCTGGGTGG + Intergenic
1145905439 17:28513801-28513823 CCTTTGGGGCCATGGCTGGGTGG + Intronic
1146958621 17:36953100-36953122 CCTTGGGAGCAGTGAGGAGGAGG + Exonic
1147559784 17:41501655-41501677 CCATTGGGGCAGTGAATGGGAGG + Intronic
1147628581 17:41915722-41915744 GAAATGGAGCAGTGGGTGGGGGG - Intronic
1148131729 17:45266426-45266448 CCTCTGGCACAGTGGGAGGGAGG - Intronic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148821751 17:50364027-50364049 CCTTCAGAGCAGGGGTTGGGGGG - Intergenic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149829472 17:59859140-59859162 ACTTTGGAGGTTTGGGTGGGAGG - Intergenic
1150076708 17:62198356-62198378 TCTTTGCAGCAGTGGGGGTGGGG + Intergenic
1150632149 17:66887305-66887327 TCATTGGAGTTGTGGGTGGGTGG - Intergenic
1150860440 17:68795727-68795749 TCTTAAGGGCAGTGGGTGGGGGG + Intergenic
1152305427 17:79517675-79517697 TCTTTGAAGCTGTGGGTGAGAGG - Intergenic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1152760762 17:82105959-82105981 CCTTTGGAGCAGAGGAGAGGTGG + Intronic
1153615525 18:6929884-6929906 CCTTTGGAGTGGCGGTTGGGCGG - Intergenic
1156313022 18:35942176-35942198 CCTCTTGAGCTGTGGGTTGGAGG + Intergenic
1156345079 18:36249618-36249640 CCTGTGGAGCAGTTGGAAGGGGG + Intronic
1156366906 18:36438015-36438037 CCTCTGGAGGAGTGTGTGGGAGG - Intronic
1158395355 18:57075220-57075242 CATTTTGAGCTGGGGGTGGGAGG + Intergenic
1158536037 18:58309178-58309200 CCCGTGGGGCAGTGGGGGGGAGG - Intronic
1160754187 19:749155-749177 CCTTCGGAGCCCTGAGTGGGAGG + Intergenic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1161261407 19:3339874-3339896 TCTTTGCACCACTGGGTGGGGGG - Intergenic
1162379342 19:10322608-10322630 GCTGTAGAGCAGTGGGTGAGGGG + Intronic
1162434810 19:10651629-10651651 ACTTGGGAGGAGTAGGTGGGAGG - Intergenic
1162806392 19:13139944-13139966 CCCTGGGAGCAGTGGGTAGGTGG - Exonic
1163916959 19:20248360-20248382 CCTTTACAGCTGTGGGGGGGTGG - Intergenic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1164476100 19:28577103-28577125 CCTTTGAAGCTGTGTGTGAGGGG - Intergenic
1165924631 19:39319889-39319911 CCTTTGGGGCTGCTGGTGGGAGG - Intergenic
1166517880 19:43460972-43460994 ACTTTGGAGCGTGGGGTGGGTGG - Exonic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1167103188 19:47416612-47416634 CCATTGGAGGAGGGGGTGTGGGG + Intronic
1167561158 19:50226807-50226829 CTCTGGGAGCAGTGGGTGTGGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1168516294 19:57012915-57012937 CCACGGGAGCAGTGGATGGGTGG + Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925265897 2:2566079-2566101 CCTTTGGCGCAGTGGCGGCGTGG - Intergenic
925465647 2:4105501-4105523 CCTTTGGAAGAGTTGGTGTGGGG - Intergenic
926010540 2:9402671-9402693 CTTTTTGTGGAGTGGGTGGGGGG - Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
927502805 2:23593579-23593601 CCTTTGGGGCAGTGGTGCGGAGG + Intronic
927699017 2:25256210-25256232 GCTTTTGAGCTGTAGGTGGGAGG - Intronic
927708232 2:25310270-25310292 AGTATGGAGCAGAGGGTGGGGGG - Intronic
927942990 2:27117578-27117600 CCTTTGCACCAGTGCATGGGAGG + Intronic
928212090 2:29330780-29330802 CGTTTGGAGTAGTGGGAGGAAGG + Intronic
929142129 2:38675933-38675955 ACTTTGGAGCAGTTATTGGGAGG + Exonic
929727737 2:44448205-44448227 CGTAAGGAGCAGTGGGTGGTGGG - Intronic
929897542 2:45975022-45975044 CCTTCAGAGCAGCGTGTGGGTGG + Intronic
931966611 2:67542867-67542889 TGTTTGCAGCAGTGGGTGGGAGG + Intergenic
932572614 2:72945917-72945939 GCGTGGGAGCAGGGGGTGGGTGG - Intronic
932751291 2:74373335-74373357 CCTTGGGAGTGGTGGCTGGGCGG - Intronic
932993284 2:76814729-76814751 CCTTTGTATCTGTGGGTGGTTGG - Intronic
934706556 2:96485585-96485607 CCTTTGAAGGAATGGGTGGTAGG - Intergenic
934932903 2:98442788-98442810 CCTTTGGAGTAGTGAGTTTGGGG + Intergenic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
937001619 2:118472867-118472889 GATTTGGGGCAGTGGATGGGTGG - Intergenic
937141969 2:119609774-119609796 ACTTGGCAGCAGTGGATGGGTGG + Intronic
939226326 2:139369501-139369523 CATTTGGGGCACTGTGTGGGAGG + Intergenic
940175355 2:150872040-150872062 GCTTTGGTGCACTGGGTGAGTGG - Intergenic
940405722 2:153299695-153299717 CCTTTGGAGCAGAGCTTGGTGGG + Intergenic
942042915 2:172082784-172082806 CCTTAGCAGTAGGGGGTGGGAGG + Intergenic
942402906 2:175622372-175622394 TCTTTTGAGCAGTGGCTGGGTGG - Intergenic
942944393 2:181657049-181657071 CCTTTGGAGAAGGAGGTGGAGGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
946009629 2:216554376-216554398 CCTTTGGTGGGGTGGGTGAGAGG + Intronic
946490778 2:220146916-220146938 CCTTTAGGGCAGTGACTGGGTGG - Intergenic
946588011 2:221212242-221212264 CCTTAGGAGCAGTGGTTGGTGGG - Intergenic
946749112 2:222875340-222875362 CCTTTGGAGTGGTGGGTTGGAGG + Intronic
948032584 2:234831215-234831237 CTTTTGGAGAAGTGGGTGGGAGG + Intergenic
948489389 2:238302816-238302838 CCGTTGGGGCAGTGTGTGGAGGG + Intergenic
1170762846 20:19265930-19265952 CTGGTGGTGCAGTGGGTGGGTGG + Intronic
1171461340 20:25299755-25299777 TCTCTGGGGCCGTGGGTGGGTGG + Intronic
1172110132 20:32539809-32539831 CCTTTGGAATGATGGGTGGGCGG - Intronic
1172615338 20:36279692-36279714 CCTTTGGGGAGGTGGTTGGGAGG - Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173923809 20:46765640-46765662 CCTTGGCAGCAGGCGGTGGGAGG + Intergenic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1175503257 20:59465115-59465137 CCTTTATAGCAGTGTGTGGAGGG + Intergenic
1175899921 20:62355890-62355912 CCTTCGGAGCCTTTGGTGGGAGG - Intronic
1175961478 20:62639002-62639024 CCTTTGGAGCAGGGTGTGGCTGG - Intergenic
1176092079 20:63322649-63322671 CCTTTGGCGCCTGGGGTGGGGGG - Intronic
1176366978 21:6039231-6039253 CCTGTGGTTCCGTGGGTGGGTGG + Intergenic
1178905561 21:36633122-36633144 CCTGTGGGGAAGTGGGTGTGGGG + Intergenic
1179756540 21:43499315-43499337 CCTGTGGTTCCGTGGGTGGGTGG - Intergenic
1179927924 21:44548434-44548456 CCTTTGTTGGGGTGGGTGGGTGG + Intronic
1180142510 21:45900934-45900956 CCCTTGGGCCAGTGGGTCGGGGG - Intronic
1180176789 21:46094515-46094537 CATTTGCATCTGTGGGTGGGAGG - Intergenic
1181376132 22:22459711-22459733 CTTTTTGAGGAGTAGGTGGGTGG - Intergenic
1183380782 22:37489535-37489557 CAATTGGAGTAGGGGGTGGGGGG - Intergenic
1185116532 22:48941301-48941323 TCCTGGGGGCAGTGGGTGGGGGG + Intergenic
1185374330 22:50475102-50475124 CCATTGGTCCAGAGGGTGGGAGG + Intergenic
949855233 3:8455361-8455383 CCTGTGGAGCATGGTGTGGGTGG - Intergenic
949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG + Intronic
950772557 3:15323917-15323939 CCTTTGGGGAAGTAGGTGAGTGG - Intronic
951804905 3:26633215-26633237 CCTTTGGATGAATGGGTGGATGG - Intronic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
954578477 3:51690044-51690066 CCTGTTGAGCAGTGGCTGTGAGG + Intronic
954876592 3:53806412-53806434 CCTCTGCAGCGGTGGGTGGCAGG + Intronic
955242936 3:57196253-57196275 GCTCTGGAGGAGTGGGTTGGAGG - Intergenic
956408734 3:68956174-68956196 CCTTTGAAAAAGTGGGTGGATGG - Intergenic
956699287 3:71944614-71944636 CCCAGGGAGCAGTGGCTGGGAGG - Intergenic
956820163 3:72947093-72947115 CTTTGGGAGCAGGAGGTGGGAGG - Intronic
958606052 3:96360005-96360027 CCCATGAAGCAGTGGGTAGGAGG + Intergenic
959997674 3:112696586-112696608 ACTTTGGAGCATTGGGTGATAGG + Intergenic
960423268 3:117475226-117475248 CCTCTGGAGCATGGGGTAGGAGG + Intergenic
962929081 3:140021097-140021119 CATTTGGAGCATCAGGTGGGAGG - Intronic
963602437 3:147390178-147390200 TCTTTTCAGCAGGGGGTGGGTGG - Intronic
965890619 3:173509157-173509179 TATTTGTGGCAGTGGGTGGGTGG - Intronic
966073229 3:175905031-175905053 CATTTGAAGCAGTGTGTAGGGGG + Intergenic
967112260 3:186304235-186304257 TTTTTGGAGCTGGGGGTGGGGGG + Intronic
967768633 3:193310016-193310038 ACTTGAGAGCAGAGGGTGGGAGG - Intronic
968728515 4:2259234-2259256 CTGTTGGTGCAGCGGGTGGGAGG - Intronic
969218832 4:5746208-5746230 GCTTTGAAGCAGGGGGTGGCTGG + Intronic
969946435 4:10788030-10788052 GTGTTGGGGCAGTGGGTGGGGGG + Intergenic
972420195 4:38879543-38879565 CCTTGAGAAAAGTGGGTGGGAGG - Intronic
976073773 4:81273136-81273158 CCTTTGGAACTATGGGTGGGTGG - Intergenic
976122275 4:81796225-81796247 CCATTGTAGCTGTGGGAGGGAGG + Intronic
976313805 4:83638039-83638061 CTTTTGGAGGCGTAGGTGGGTGG - Intergenic
978054669 4:104249021-104249043 CCTGTGTAGCAGTGGGTGTGGGG + Intergenic
978890512 4:113821033-113821055 AATTTGGAGCATTGGGTGCGGGG + Intergenic
978950180 4:114548633-114548655 CCTTTGGCTCAGTGAGTTGGGGG + Intergenic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
987394865 5:17413452-17413474 CTTTTGGGGCAGTGCCTGGGAGG + Intergenic
988319160 5:29670095-29670117 CTTTTGGAGCTGTGAGTGGAGGG + Intergenic
989646105 5:43634172-43634194 TCTCTGGAGAATTGGGTGGGAGG + Intronic
992303156 5:75405901-75405923 CCATTGTATCAGTGGTTGGGGGG - Intronic
995032355 5:107494520-107494542 GCCATGGAGCAGAGGGTGGGAGG - Intronic
998236533 5:140402561-140402583 GCTTTGGAGTTGGGGGTGGGGGG + Intronic
999153783 5:149443732-149443754 CCTTTTCAGAAGTGGGTGGGAGG - Intergenic
999295794 5:150458832-150458854 CCTTGGGGGCGGTGGGTGAGAGG + Intergenic
999488390 5:152023842-152023864 CGTTTGAAGCAGTGGGTAGAGGG - Intergenic
999858222 5:155618103-155618125 CTTTTGGGGCAGGGGATGGGAGG + Intergenic
1000565288 5:162839635-162839657 CAAATGAAGCAGTGGGTGGGGGG - Intergenic
1001261201 5:170230900-170230922 GCTTAGGAGAAGTAGGTGGGTGG - Intergenic
1001396321 5:171421382-171421404 CCCTTGCAGCACTAGGTGGGTGG - Intronic
1001596651 5:172902971-172902993 CCTGGGGAGGTGTGGGTGGGGGG - Intronic
1003565964 6:7222466-7222488 GCTGTGGAACAGTGGGTGGTAGG - Intronic
1003672049 6:8168542-8168564 GCTTTGAAGGAGTGGGTGGGAGG + Intergenic
1005652280 6:27895272-27895294 CCTTTGCAGCTATGGGTGGAAGG + Intergenic
1005750933 6:28881931-28881953 TGTTTGGAGCTGGGGGTGGGTGG + Intergenic
1005888908 6:30120275-30120297 AGTTTGGAGCAGTGGGTGAGAGG - Intergenic
1006187313 6:32188796-32188818 CCTTGGGAGGAGTGGGAGTGGGG + Exonic
1007237214 6:40399315-40399337 GCATGGGAGCAGTGGGTGGGGGG - Intronic
1011015944 6:82755744-82755766 CCTTTGAAGCAGTGTGTAGAGGG - Intergenic
1012437114 6:99226486-99226508 CCCATGGCGCAGAGGGTGGGGGG - Intergenic
1013541095 6:111110228-111110250 TCTGTGGAGCAGTGAATGGGAGG + Intronic
1013997341 6:116324101-116324123 CCTTTGGAGCCTGGGGTGAGGGG - Intronic
1016576983 6:145580665-145580687 ACTTTAGAGTAGAGGGTGGGAGG - Intronic
1018704816 6:166455999-166456021 CCTGTGGAGGAGTGTGTGCGGGG + Intronic
1019117600 6:169777779-169777801 GCGCTGGAGCTGTGGGTGGGGGG - Intronic
1019287399 7:230500-230522 CCTGTGGGGCCGTGGGTGGATGG + Intronic
1021845093 7:24756640-24756662 ACTCTGGAGGAGTGGGTGGTCGG + Intronic
1022375495 7:29807372-29807394 CCTTTGGAGGATTAGGTGGTGGG + Intronic
1022477752 7:30722884-30722906 CCTTTGGAGCTGAGGGCAGGGGG + Intronic
1022837485 7:34131571-34131593 CCTTTGAAGCAGGGGGCTGGTGG + Intronic
1023723340 7:43117422-43117444 CCTTTGGTGGGGCGGGTGGGGGG - Intronic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1024293702 7:47826252-47826274 CCTTTGGAGGTGTGTGTGGTGGG + Intronic
1026209833 7:68294323-68294345 GCTTTGCTGCACTGGGTGGGTGG - Intergenic
1026845936 7:73699273-73699295 CCTTTGGTGAAGGGGTTGGGGGG + Exonic
1026850691 7:73721454-73721476 CCTGTGGAGGAGTGGGAGTGGGG + Intergenic
1026894649 7:74003096-74003118 ACTTTGGAGGTGAGGGTGGGGGG + Intergenic
1026978792 7:74514669-74514691 TCCTTGGAGCAGGGGTTGGGGGG + Intronic
1027331946 7:77106397-77106419 CCTTTGTGCCAGTAGGTGGGTGG - Intergenic
1029783830 7:102764927-102764949 CCTTTGTGCCAGTAGGTGGGTGG + Intronic
1030380811 7:108809836-108809858 CCTTTGGGGAAGTGTGTGAGAGG + Intergenic
1032284958 7:130532832-130532854 CTGGTGGAGCAGTGGGTGCGGGG + Intronic
1032285753 7:130537369-130537391 CTGGTGGAGCAGTGGGTGCGGGG + Intronic
1032286516 7:130541795-130541817 CTGGTGGAGCAGTGGGTGCGGGG + Intronic
1032566742 7:132954517-132954539 ATTTTGGAGCAGTGGTTGAGAGG + Intronic
1034210783 7:149360207-149360229 GCTCTGGGGCAGTGGGTGGGTGG - Intergenic
1034974191 7:155438445-155438467 CAACTGGAGCTGTGGGTGGGGGG - Intergenic
1035588301 8:793986-794008 CCTTTTGGCCTGTGGGTGGGGGG + Intergenic
1036704597 8:11037466-11037488 CTTTTGGAGCCGGAGGTGGGTGG - Intronic
1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG + Intronic
1038475938 8:27868190-27868212 TTTTTGGAGCTGGGGGTGGGGGG - Intergenic
1038503413 8:28063880-28063902 GCTCTGGAGCACAGGGTGGGAGG - Intronic
1038702595 8:29863006-29863028 GCTTTGCTGCACTGGGTGGGTGG - Intergenic
1039607269 8:38891683-38891705 CCACTGGAGAAGTGGGTGAGAGG - Intergenic
1040470271 8:47730781-47730803 CCTGAGGTGCAGTGGGTGAGAGG - Intronic
1043401539 8:79890086-79890108 GATTTGGGGCTGTGGGTGGGTGG + Intergenic
1044418011 8:91958094-91958116 GCTTTGGGGCGGGGGGTGGGGGG - Intronic
1045159866 8:99526648-99526670 GTTTTGGAGGATTGGGTGGGTGG + Intronic
1048428103 8:134341339-134341361 CCTTTGGTGCAGTGGGAGAGTGG - Intergenic
1048541808 8:135348864-135348886 GCTCTGGAGGAGTGGGTTGGAGG - Intergenic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1049255994 8:141614194-141614216 TCCTTGGAGCAGGGGGAGGGAGG + Intergenic
1050082926 9:1934225-1934247 CATTTAAAGCAGTGTGTGGGGGG - Intergenic
1051631304 9:19143574-19143596 CTTTGGGAGGAGTGGGGGGGCGG - Intronic
1052691348 9:31820562-31820584 GCTCTGGAGCTGTGGCTGGGTGG - Intergenic
1052840533 9:33288809-33288831 CCCTGGGAGCAGTAGGTAGGCGG - Intergenic
1053284887 9:36843770-36843792 CCCTTGAAGCAGTGGGCTGGGGG + Intronic
1053752375 9:41269410-41269432 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1054257903 9:62833742-62833764 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1054812013 9:69442436-69442458 CCTTTGGAGTAGTGGGCCTGGGG - Intronic
1055042551 9:71891032-71891054 CCTTTGGGTAAGGGGGTGGGGGG - Intronic
1056756640 9:89385868-89385890 CCTTGGCAGGGGTGGGTGGGCGG - Intronic
1057083601 9:92189775-92189797 CGTTTGAAGCAGAGGGTGTGGGG - Intergenic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1057929756 9:99183644-99183666 CCGTTGCAGCAGTGGTTGAGTGG + Intergenic
1058963210 9:110011532-110011554 GCATTGGACCAGTGGGTAGGAGG - Intronic
1059438544 9:114290172-114290194 CATTTGGTGCAGGGAGTGGGAGG - Intronic
1061417329 9:130454208-130454230 TCTCTGTAGCAGGGGGTGGGAGG + Intronic
1062039722 9:134398688-134398710 CATCTGGAGCAGGGGGTGGGTGG + Intronic
1202800872 9_KI270719v1_random:174638-174660 CAGGTGGAGGAGTGGGTGGGAGG + Intergenic
1186730417 X:12403566-12403588 CCTTAGGAGCAGTGGGTTTGTGG - Intronic
1188615586 X:32155231-32155253 GCGTGTGAGCAGTGGGTGGGAGG - Intronic
1189232976 X:39466416-39466438 CCTAGGAAGCAGTGAGTGGGGGG - Intergenic
1189529630 X:41866158-41866180 GTTGTAGAGCAGTGGGTGGGAGG + Intronic
1189988096 X:46571583-46571605 CTTTTGGAGCGGAGGGCGGGGGG + Intergenic
1190877954 X:54472898-54472920 CCTTTGTGGCTGTGAGTGGGAGG - Intronic
1195411274 X:104569157-104569179 CCTTTGGAGCAGTAGGGTTGAGG + Intronic
1196814612 X:119654836-119654858 CCTTCGGAACAGTGGCTCGGAGG - Intronic
1196909159 X:120468617-120468639 GCTTGGGAGAAGTGTGTGGGTGG - Intronic
1197004603 X:121480903-121480925 CCTTTGAAGCAGCTGGTAGGAGG + Intergenic
1197971593 X:132120503-132120525 GCTTTGGAGCTATAGGTGGGTGG - Intronic
1198344493 X:135746463-135746485 CCTTTGTAGCTGTAGCTGGGAGG - Intergenic
1199764381 X:150930322-150930344 CCTTTGAAGAGGTGGGCGGGGGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200059198 X:153476799-153476821 TGTCTGGAGCAGAGGGTGGGAGG - Intronic