ID: 987117958

View in Genome Browser
Species Human (GRCh38)
Location 5:14741336-14741358
Sequence CTCAGCAGACAGATGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 2, 2: 0, 3: 25, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987117958 Original CRISPR CTCAGCAGACAGATGGGCCT GGG Intronic
900427540 1:2587373-2587395 TCCAGCAGACAGAAGGGCCGGGG - Intronic
901757773 1:11451725-11451747 CTCTGGAGCCAGGTGGGCCTGGG + Intergenic
902148667 1:14424840-14424862 CTCAGCAAGCAGATGGGGCCTGG - Intergenic
902728024 1:18350227-18350249 CTCAAGAGCCAGATGGGCCAGGG + Intronic
902800523 1:18826784-18826806 ATCAGCAGGCAGATGGGCTGGGG + Intergenic
903070078 1:20722726-20722748 CGCAGCAGCCAGAGGGGCCTGGG - Intronic
903672128 1:25042822-25042844 CTCAGCAGAGAGGAGGACCTGGG + Intergenic
905369628 1:37476138-37476160 CTCTGCGGACAGAGGGACCTGGG - Intronic
905473076 1:38207567-38207589 CTCAGCAGACAGATGGACCTGGG + Intergenic
905885454 1:41489437-41489459 CTCAGCAGGCAGAGAGCCCTAGG + Intergenic
906241312 1:44243900-44243922 CTCTGCACTCAGATGGGCTTGGG + Intronic
906536387 1:46553061-46553083 TGCAGCACACAGATGGGCCCTGG + Intergenic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
907916040 1:58870787-58870809 CTCAGCAGACAGAAGCCCTTGGG - Intergenic
909303298 1:74040007-74040029 CACAGCACACTGATGGGTCTTGG - Intronic
910801582 1:91152581-91152603 CTCAGCCTGAAGATGGGCCTAGG - Intergenic
911477117 1:98387229-98387251 TGCAGCAGCCACATGGGCCTGGG - Intergenic
912432878 1:109638759-109638781 ATCTGGAGTCAGATGGGCCTGGG - Intergenic
914341298 1:146762726-146762748 AGCTGCAGACAAATGGGCCTGGG + Intergenic
915277852 1:154801885-154801907 CTCAGCAGTCTGATGGGAGTGGG + Intronic
915603839 1:156938736-156938758 CCCAGGAGACAGGTGGCCCTTGG + Intronic
916077058 1:161207390-161207412 TTCAGCAGACAGCTAGGACTTGG + Intronic
917488089 1:175473593-175473615 CTCTGTAGACATTTGGGCCTTGG - Intronic
918210792 1:182349317-182349339 GTAAGCACACAGCTGGGCCTGGG - Intergenic
920247764 1:204601147-204601169 CCCAGCAGACATCTGGGACTAGG + Intergenic
923114635 1:230923609-230923631 TACACCAGACAGAAGGGCCTGGG + Intronic
924828052 1:247562593-247562615 CACAGTAGAGAGATGTGCCTGGG - Intronic
1062838215 10:650242-650264 CTCAGGAGACAGCTGGCCCGAGG + Intronic
1062980838 10:1721156-1721178 GTCAGCAGAAAGAAGGGCCCTGG + Intronic
1063031202 10:2237227-2237249 CTCAGCAGATTGATAGGCATAGG + Intergenic
1063191093 10:3695734-3695756 CCCAGCAGAGAGATGGGAGTGGG + Intergenic
1064190348 10:13200604-13200626 CTCCACAGACAGGAGGGCCTGGG - Intronic
1064361646 10:14671176-14671198 TGCAGCAGACTGATGGGCGTGGG - Intronic
1067159150 10:43808035-43808057 CTCAGCACTGAGATGGTCCTAGG + Intergenic
1067337192 10:45375057-45375079 CTGAGCCACCAGATGGGCCTGGG - Intronic
1067580431 10:47442140-47442162 CTTAGAAGACAGCTGAGCCTTGG - Intergenic
1067828511 10:49596667-49596689 CTCTGCTGAGAGATGGACCTTGG + Intergenic
1068237280 10:54254610-54254632 CTCAGCATACTGAAGGACCTTGG + Intronic
1069718172 10:70533979-70534001 TTCAGCTGCCAGATGGGCGTGGG + Exonic
1069788356 10:71004150-71004172 CTCCGCAGCCAGCTGGGCTTGGG - Intergenic
1069807105 10:71132873-71132895 CCCAGCAGACAGGTGGAGCTGGG - Intergenic
1070289124 10:75103464-75103486 CTCAGGGGACAGTGGGGCCTGGG - Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1073442819 10:103562828-103562850 CCCAGCACAGAAATGGGCCTGGG + Intronic
1073867237 10:107818981-107819003 TGGAGCAGACAGATGGGGCTGGG + Intergenic
1074103780 10:110374230-110374252 CTGGGCATACAGGTGGGCCTGGG + Intergenic
1074538141 10:114343658-114343680 CTCAGCAGACAGAGAAGCATCGG + Intronic
1074568634 10:114604246-114604268 CTTAGCAGTCAGAAAGGCCTGGG - Intronic
1074702032 10:116100930-116100952 CTCAGCAGACAGTGGGGCCCTGG + Intronic
1074848058 10:117416252-117416274 GGAAGCACACAGATGGGCCTAGG + Intergenic
1075071190 10:119320882-119320904 CCCAGCAGTGAGGTGGGCCTAGG + Intronic
1075840129 10:125494350-125494372 GCCAGCAGACAGATGGGGGTTGG - Intergenic
1076014205 10:127014834-127014856 GTAAGCAGACAGATGGGCAAAGG - Intronic
1076133604 10:128029875-128029897 CTCAGCAGTCAGATCCGCCCAGG + Intronic
1077273277 11:1691791-1691813 CCCAGCAGTGAGATGGGCCATGG - Intergenic
1077586555 11:3458262-3458284 CTGAGCAGACAGAAAGGACTTGG - Intergenic
1081656281 11:44859607-44859629 CTCAGCAGACAAATGCTTCTTGG - Intronic
1083315761 11:61814233-61814255 CTCAAAAGGCAGCTGGGCCTAGG - Intronic
1083727745 11:64637227-64637249 CCCAGCAGACAGAGGGGGCTTGG + Intronic
1085534190 11:77208265-77208287 CTCAGCAGGCACATGGGGCAGGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089399240 11:118154921-118154943 CTCAGCAGACAGCTAGGCACAGG + Intergenic
1090910104 11:131111253-131111275 CTCAGCAGAGAGAAGACCCTGGG + Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1091801766 12:3328900-3328922 CTCAGCAGACAGACGGGTGAGGG - Intergenic
1092412782 12:8266996-8267018 CTGAGCAGACAGAAAGGACTTGG - Intergenic
1095706250 12:45240471-45240493 TTCAGCACACTGATGGGTCTTGG + Intronic
1095780315 12:46051536-46051558 GACAGCAGACAGATGGGTCTTGG - Intergenic
1095844500 12:46730849-46730871 TGCAGAAGACAGATGGGTCTTGG - Intergenic
1095955968 12:47806268-47806290 CTTTGCGGTCAGATGGGCCTGGG + Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1098578779 12:72074321-72074343 TTCTGGAGACAGATGGACCTGGG + Intronic
1099326789 12:81226477-81226499 ATCAGAAGACAGATGAGCCTGGG - Intronic
1099365813 12:81764490-81764512 TGCAGAAGACAGATGGACCTTGG + Intergenic
1103548324 12:121717587-121717609 CTCAGGGCACAGATGAGCCTAGG - Intronic
1103992681 12:124809825-124809847 CTCAGCACCCAGATGGTCATGGG + Intronic
1104433138 12:128732942-128732964 CTCAGCAGGCAGGTGGCCTTTGG + Intergenic
1104725432 12:131072696-131072718 CTCTGCAGGCTCATGGGCCTGGG + Intronic
1104945953 12:132414972-132414994 TCCAGCAGAGAGAAGGGCCTGGG + Intergenic
1106552420 13:30783693-30783715 CTTAACAGACAAATGAGCCTAGG + Intergenic
1107627207 13:42301148-42301170 ATCAGATGACAGATGAGCCTTGG - Exonic
1107690480 13:42948173-42948195 CCCAGCAGCCAGCTGGGTCTGGG + Intronic
1110213145 13:72996215-72996237 CTCAGTAGAAAAATGGGCCAAGG + Intronic
1112505141 13:99970825-99970847 CTCAACGGCCAGATGCGCCTGGG - Exonic
1112507304 13:99982587-99982609 CTCAACGGGCAGATGCGCCTCGG + Exonic
1112669988 13:101624488-101624510 CTCAGGATACAGATTGACCTGGG + Intronic
1113074493 13:106454547-106454569 CACCCCAGACAGATGGGCCATGG - Intergenic
1114743844 14:25125363-25125385 CTTTGGAGACAGATGGGCTTGGG - Intergenic
1116328462 14:43565218-43565240 CCCAGCAGACTGAGGGGCCATGG + Intergenic
1116897580 14:50332098-50332120 TTCAGGAGACAGATGTCCCTGGG + Exonic
1118903858 14:70008959-70008981 CTGAGCAGGGAGAGGGGCCTTGG - Intronic
1119084424 14:71727052-71727074 CTCTGCTGACAAATGAGCCTGGG - Intronic
1121791455 14:96702584-96702606 CTTAGCAGAGGGAAGGGCCTGGG + Intergenic
1122351907 14:101100985-101101007 CTCAACAGACTCATTGGCCTTGG - Intergenic
1122831023 14:104395951-104395973 CTCAGCAGCCAAAGGGGCCCTGG - Intergenic
1122903359 14:104791066-104791088 CCCATCAGCCAGCTGGGCCTAGG - Intronic
1123011235 14:105350539-105350561 CTCAGCAGCCACGTGGCCCTTGG + Intronic
1123040692 14:105489095-105489117 CTCAGCAGGCCGAGAGGCCTGGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124820911 15:33044736-33044758 CTCAGCAGAGAGAAGACCCTTGG - Intronic
1127391924 15:58512694-58512716 TTCAGCAGACAGAGGCGCCCTGG + Intronic
1128744727 15:70105571-70105593 CTTTGGAGACAGAGGGGCCTGGG - Intergenic
1129509535 15:76110633-76110655 CACAGCAGACAGATACACCTGGG - Intronic
1130026062 15:80271515-80271537 CTCAGCACAGAGATGGTCATTGG - Intergenic
1130097639 15:80867815-80867837 GTCAGGAGAGAGCTGGGCCTGGG + Intronic
1130879781 15:88045067-88045089 CTCAACAGAGAGCTGGGCCTGGG - Intronic
1132007081 15:98237093-98237115 CCCTACATACAGATGGGCCTTGG + Intergenic
1132305888 15:100812064-100812086 CACAGAAGACAGATGGATCTTGG - Intergenic
1132533684 16:466819-466841 AGCAGCTGACAGATGGGCCTGGG + Intronic
1133606676 16:7394375-7394397 CTAAGGAGACAGAAGGGACTGGG - Intronic
1133740551 16:8647938-8647960 CTCAGGAGTCAGATGGACATGGG - Exonic
1134207457 16:12249801-12249823 CTCAGCACACAGGTGGGTTTTGG - Intronic
1134903484 16:17959619-17959641 CTCAGGAGACAGAAGAGGCTAGG + Intergenic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136052968 16:27666132-27666154 CTCAGGAAGTAGATGGGCCTGGG - Intronic
1136120631 16:28131207-28131229 CCCAGGAGGCTGATGGGCCTTGG - Intronic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1137849473 16:51724674-51724696 CTCTGGAATCAGATGGGCCTGGG - Intergenic
1138184311 16:54964492-54964514 CTCTGGAGCCAGATAGGCCTTGG - Intergenic
1139327239 16:66161890-66161912 TTCTGGAGACACATGGGCCTGGG + Intergenic
1139992983 16:70954682-70954704 AGCTGCAGACAAATGGGCCTGGG - Intronic
1140643333 16:77002649-77002671 CTCAGCAGGTGGATGGGGCTAGG - Intergenic
1140860014 16:79010323-79010345 CTCAGGCGACAGATGGGACCAGG + Intronic
1141172471 16:81700160-81700182 CTCATCAGTCAGATGGGGCCAGG + Intronic
1141600867 16:85125517-85125539 TTCAGCAGACAGAAGGGCCAGGG + Intergenic
1141643106 16:85352926-85352948 CTCAGCAGACAGTGGTGCCAGGG + Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1143113134 17:4564553-4564575 GGCAGAAGACAGATGGGCCTTGG + Intergenic
1143324967 17:6092719-6092741 CTGAGCAGGCAGATGGGGCTGGG - Intronic
1144653738 17:17022436-17022458 CTCAGAGGACAGATGTGTCTGGG - Intergenic
1144768683 17:17746928-17746950 CTCAGAAAACACATGGGGCTGGG - Intronic
1146761551 17:35483118-35483140 CTCAGCAGAGAGGAGGCCCTGGG - Intronic
1147268829 17:39252349-39252371 CTCTGCAGAGAGAAGGGACTTGG + Intergenic
1147521816 17:41180694-41180716 CTCAGCAGTCAACTCGGCCTGGG + Intergenic
1148386256 17:47237285-47237307 CTCAGCAGACAGGAGACCCTGGG + Intergenic
1149574666 17:57702995-57703017 ATCCTCAGACAGATGGGCCCTGG - Intergenic
1149867033 17:60156806-60156828 CTCACAGCACAGATGGGCCTGGG - Intronic
1150529186 17:65959056-65959078 CTCAGCAGAGAGTAGGCCCTGGG - Intronic
1151473902 17:74334551-74334573 CTAAGCAGCCAGCTGGGCTTTGG + Intronic
1152132195 17:78484425-78484447 CCCAGCAGAGAGATGCCCCTGGG - Intronic
1152470182 17:80486888-80486910 CTCAGCTCACAGCTTGGCCTTGG + Intergenic
1153776420 18:8458241-8458263 CTCAGCAGACACAGGGGTCTAGG + Intergenic
1154960817 18:21307108-21307130 CACAGAAGACAGTTGGGACTGGG - Intronic
1154979470 18:21490659-21490681 CTCAGAAAACAGATGGCCATGGG - Intronic
1155288065 18:24312032-24312054 CTCATCAGTCAGCTGGTCCTGGG + Exonic
1155741871 18:29298891-29298913 TGCAGAAGACAGATGGACCTTGG - Intergenic
1157226956 18:45874896-45874918 CTCAGCAGGCAAATAGTCCTCGG - Intronic
1157813150 18:50711961-50711983 CTCAGCTGACAGCAGGGCCCTGG + Intronic
1159001672 18:62980455-62980477 CTCAGCAGCCAGATGTTTCTTGG + Intergenic
1160334781 18:78029159-78029181 CTCTGGAGTCTGATGGGCCTGGG + Intergenic
1160537935 18:79604865-79604887 CTCAGCAGCCAAATGTCCCTGGG + Intergenic
1160975666 19:1791075-1791097 ATCAGCAGGCACATGTGCCTAGG + Intronic
1162263635 19:9552410-9552432 CTCAGCAGAGAGGAGGCCCTTGG + Intergenic
1162543841 19:11315865-11315887 TCCAGCAGCCAGATGGGCCCAGG - Intronic
1163491543 19:17619840-17619862 CTGACAAGCCAGATGGGCCTGGG + Intronic
1164616455 19:29669434-29669456 CTCAGCACACAGCTGGGCTGGGG + Intronic
1164675393 19:30097167-30097189 GTCAGCAGGCAGATGGGCAGCGG - Intergenic
1165898018 19:39155075-39155097 CACAGCAGACAGACGCACCTGGG - Intronic
1166206530 19:41273290-41273312 GTCAGCAGCCAAATGGGCATGGG + Intronic
1166342365 19:42146337-42146359 CTCAGCAGAAACACTGGCCTTGG + Intronic
1166370328 19:42296721-42296743 CTCAGGAGTCAGATCAGCCTGGG + Intergenic
1167771574 19:51523614-51523636 CTCAGCAGTCTGATGGAACTGGG + Intronic
1167781904 19:51603864-51603886 CTCAGCAGTCTGATGGAACTGGG + Intergenic
1168193254 19:54755536-54755558 TTCAGTAGAGATATGGGCCTGGG + Intronic
1168376154 19:55881499-55881521 CTCAGCCGTCAGAAGTGCCTGGG - Exonic
1168641604 19:58034694-58034716 TTCAGGAGGGAGATGGGCCTGGG - Intronic
925419696 2:3702486-3702508 CTCAGGAGGCAGATGGAGCTGGG - Exonic
925996980 2:9301503-9301525 CTCAGCACAGAGGTGGCCCTTGG - Intronic
926949219 2:18223504-18223526 CTTAGCAGCCACATGTGCCTAGG + Intronic
927672891 2:25083758-25083780 CTCAGAGGTCAGATGGGCTTAGG - Intronic
928668810 2:33579427-33579449 CTCTGGAGCCAGATGGCCCTAGG + Intergenic
929640867 2:43578678-43578700 CTGAGCAGCCAGATAGGCCTGGG + Intronic
931989328 2:67774047-67774069 TTCAGCAGACACATAAGCCTTGG + Intergenic
936031999 2:109079937-109079959 CTCAGCAGGCACAGGGTCCTTGG - Intergenic
936059025 2:109282548-109282570 CTCAGCTGACTGCAGGGCCTGGG + Intronic
937335525 2:121059936-121059958 CTTGGCAGGCTGATGGGCCTGGG + Intergenic
938288915 2:130139194-130139216 CCCTGCAGACAGCGGGGCCTGGG + Intergenic
938467619 2:131533737-131533759 CCCTGCAGACAGCAGGGCCTGGG - Intergenic
938706268 2:133930394-133930416 CTCACCAGGCACATGGGTCTTGG - Intergenic
938776243 2:134544042-134544064 CCCAGGAGACAGCTGGGCCTGGG + Intronic
942237855 2:173929790-173929812 CTCAGCAGGCAGATAGGTCAGGG + Intronic
945250657 2:207763903-207763925 CACAACACACACATGGGCCTTGG + Exonic
945805175 2:214481385-214481407 CTCAGCTGACAGCTAGGACTGGG + Intronic
946049707 2:216852294-216852316 TTCAGCAGACAGAAGCTCCTTGG - Intergenic
947665911 2:231905161-231905183 CTCAGCAGACAGGCAGGGCTGGG + Intergenic
947871287 2:233440329-233440351 CTCAGAAGACAGACAGGCATAGG - Intronic
948126365 2:235567379-235567401 CTCAGCTGGGAGATGGGCCCTGG + Intronic
948696322 2:239734842-239734864 CTCAGCAGAGGGGTGGCCCTAGG - Intergenic
1168919414 20:1518560-1518582 CTCAGCAGACAGATGGACCTGGG + Intergenic
1170270591 20:14523254-14523276 ACCAGCAGACAGAGGGGCCCTGG + Intronic
1171723015 20:28584301-28584323 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171755069 20:29099151-29099173 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1171787618 20:29483741-29483763 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171860336 20:30395640-30395662 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
1172227379 20:33314321-33314343 CTCTGCAGCCAGACAGGCCTGGG - Intergenic
1173236348 20:41249546-41249568 CTCCACAGACTGATGGGCCTGGG - Intronic
1173401111 20:42726701-42726723 CTCACCACACAGTAGGGCCTCGG + Intronic
1173890726 20:46507633-46507655 CTCTGCAGACACCTGGGCTTTGG + Intronic
1173905934 20:46628773-46628795 CTCAACAGCCACATGGGACTAGG + Intronic
1175143175 20:56875501-56875523 CTCAGCAGCCACATGGCCCAGGG + Intergenic
1175552338 20:59825728-59825750 CTCAGCAGAGGGAAGGGCCCAGG + Intronic
1180412101 22:12623024-12623046 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1180594212 22:16962997-16963019 CTCAGCAGCCTGGGGGGCCTGGG + Intronic
1180979516 22:19872079-19872101 CTCTCCATCCAGATGGGCCTGGG - Intergenic
1182988234 22:34741589-34741611 CTCTGCAGACAGACAGGCCTGGG - Intergenic
1183477448 22:38043282-38043304 CTCAGCTGAGGGATGGGGCTGGG - Intergenic
1183701405 22:39453277-39453299 CTCTGCAGACCAATGGGCCTAGG + Intergenic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1185139033 22:49089992-49090014 CTCAGCAGAGAGCAGGGGCTTGG + Intergenic
949461639 3:4301186-4301208 CTGAGCAGACAGACAGTCCTGGG + Intronic
949487889 3:4557767-4557789 CTCAGAAGCCAGATGGGGGTAGG + Intronic
950261286 3:11544677-11544699 CTCAGAAGCCAGCTGGGCCGAGG + Intronic
950426664 3:12928094-12928116 CTCAGCTGCCAGCTGGGCCCTGG - Intronic
950447733 3:13047909-13047931 CTCAGCAGACCCATGGGTTTGGG + Intronic
950824888 3:15808115-15808137 CTTCGGAGACAGATGGGTCTGGG - Intronic
951667650 3:25145074-25145096 CTCAGTCTACAGAAGGGCCTTGG - Intergenic
951822658 3:26829496-26829518 GACAGCAGACCGATGGGTCTTGG - Intergenic
953707210 3:45240365-45240387 CTCAACAGACAGCAAGGCCTTGG - Intergenic
953889013 3:46736676-46736698 CACTGCAGAGAGCTGGGCCTAGG - Intronic
954290943 3:49649741-49649763 CTCAGCAGACAGACAGGCACTGG - Intronic
955241463 3:57182374-57182396 CTCAGCAGAGAGGAGGCCCTGGG + Intergenic
956166464 3:66401614-66401636 CCCAGCAGACATATGGGGCTGGG + Intronic
957057884 3:75458186-75458208 CTGAGCAGACAGAAAGGACTTGG - Intergenic
959863640 3:111242698-111242720 CTCAGCAGAGAGGAGGTCCTGGG + Intronic
960054111 3:113264528-113264550 CTTTGCAGACAAAGGGGCCTGGG + Intronic
961011710 3:123440751-123440773 GTTAGTAGAAAGATGGGCCTAGG - Intronic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961791114 3:129377668-129377690 CTCAGCAGAGAGGAGGCCCTGGG + Intergenic
961942935 3:130656410-130656432 CTCAGCAGAGAGGAGGCCCTGGG + Intronic
962025244 3:131540888-131540910 CTCAGGTGACAGAGGGGACTCGG + Intronic
962033890 3:131630654-131630676 CTCAGGAGACATATGTGGCTAGG + Intronic
963439687 3:145322244-145322266 ATCAGAAAGCAGATGGGCCTTGG + Intergenic
965541465 3:169875567-169875589 CTCAGCAGAGAGGAGGCCCTTGG - Intergenic
965757585 3:172040772-172040794 CTCGGCAGAAAGTGGGGCCTCGG + Intronic
968041247 3:195591114-195591136 CTCAGCTGGGAGATGGGCCAGGG + Intergenic
969188563 4:5498767-5498789 CACTGTAGCCAGATGGGCCTCGG - Intronic
969486667 4:7476066-7476088 CTCAGGAGAGAGAAGCGCCTGGG - Intronic
972201411 4:36718057-36718079 TGCAGAAGACAGATGGACCTTGG - Intergenic
972319919 4:37964182-37964204 CTCTGCACACACATGGGCCAGGG + Intronic
974785636 4:66616930-66616952 GACAGCAGACAGATGGGTCTTGG + Intergenic
975671653 4:76786806-76786828 CGCAGCAGCCACATGGGCCGTGG - Intergenic
975760251 4:77613249-77613271 CTTAGGAGTCAGATGGCCCTGGG - Intergenic
975885764 4:78962901-78962923 CTAAGCAAACACATGGGGCTTGG + Intergenic
975982726 4:80178174-80178196 TGCAGAAGACAGATGGACCTTGG - Intergenic
977204584 4:94154699-94154721 TTCAGAAGACAGATGGATCTTGG + Intergenic
977901270 4:102424907-102424929 CCCAGCAGAGATGTGGGCCTTGG + Intronic
978219698 4:106255997-106256019 CTCAGCAGAGAGAAGACCCTGGG + Intronic
978234133 4:106437453-106437475 CTCAGGTGACTGATTGGCCTCGG + Intergenic
980738309 4:136918385-136918407 CTCAGCAGAGAGGAGGCCCTAGG - Intergenic
981011809 4:139933028-139933050 CACAGCAGACAGACAGGCCAAGG + Intronic
982847656 4:160273389-160273411 TGCAGAAGACAGATGGACCTTGG + Intergenic
984856184 4:184198135-184198157 CTCAGCCAACAGACGGGGCTTGG + Intronic
985438501 4:189959462-189959484 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
985735394 5:1577164-1577186 GACAGTAGCCAGATGGGCCTAGG - Intergenic
985958598 5:3282680-3282702 GCCTGCAGACAGCTGGGCCTTGG + Intergenic
986059490 5:4174579-4174601 CTCAGCAGAAAGACGGGGCTAGG + Intergenic
986286293 5:6361355-6361377 CAGAGCAGACAGGTGAGCCTGGG + Intergenic
987117958 5:14741336-14741358 CTCAGCAGACAGATGGGCCTGGG + Intronic
987202968 5:15595932-15595954 CTCAGCAGGTAGATGGGATTTGG + Intronic
987293394 5:16528880-16528902 GTAAGCAGACAGATGAGCGTGGG + Intronic
987328003 5:16829775-16829797 CTCAGCAACCAGAAAGGCCTCGG + Intronic
988169300 5:27633709-27633731 TGCAGAAGACAGATGGACCTTGG - Intergenic
988311295 5:29561364-29561386 CTCAATAGACAGATGGGTCTTGG + Intergenic
989657204 5:43757996-43758018 TACAGCATACTGATGGGCCTAGG + Intergenic
991636744 5:68713796-68713818 TTCTGCAGTCAGATGGGACTAGG - Intergenic
993124908 5:83821929-83821951 CTAAGCAGATAAATGGGCTTAGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
996147619 5:119995106-119995128 CTCACCAGACAGATGGGGGTGGG + Intergenic
997103603 5:130994645-130994667 ATCAGCAGGCGGATAGGCCTAGG + Intergenic
999096121 5:148979442-148979464 GGCAGAAGCCAGATGGGCCTCGG - Intronic
1000250652 5:159491717-159491739 CTCATCAGAAAGGTGGGCCCTGG + Intergenic
1000462440 5:161539284-161539306 CTGAGCAGAAAGCTTGGCCTTGG - Intronic
1001403521 5:171460518-171460540 CTCTAGAGACAGAAGGGCCTGGG - Intergenic
1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG + Intronic
1001822236 5:174719437-174719459 CTCTGCAGACAAATCAGCCTCGG + Intergenic
1001941237 5:175741156-175741178 CTCTGGAGACAGAGGGGTCTGGG - Intergenic
1004298996 6:14440217-14440239 CTCAGCGAACAAATGGGCTTAGG + Intergenic
1005182188 6:23118489-23118511 CTTAGCAGACAAAGAGGCCTTGG + Intergenic
1006077797 6:31545549-31545571 CTCAGCAGACAGGTTCCCCTGGG + Exonic
1007658236 6:43465881-43465903 CCCAGGGGAAAGATGGGCCTGGG - Intergenic
1011283277 6:85698689-85698711 TACAGCACACAGATGGGTCTTGG + Intergenic
1012141981 6:95636243-95636265 CTCAGCAGACAGGAGAACCTGGG + Intergenic
1014328262 6:120027145-120027167 CTCAGAAGACAGATTATCCTGGG - Intergenic
1015669429 6:135672076-135672098 ATGTGCAGACAGCTGGGCCTGGG + Intergenic
1017908607 6:158773665-158773687 CTCTGCGGCCAGATGAGCCTTGG - Intronic
1019296050 7:276034-276056 CTCAGCAGACAGGAGGCCCTGGG + Intergenic
1019856462 7:3613274-3613296 CTCTGCAGATAGATGGGTCATGG + Intronic
1021581335 7:22157070-22157092 CTGAGCAATCTGATGGGCCTGGG + Intronic
1021916771 7:25441995-25442017 GACAGCATACAGATGGGTCTTGG + Intergenic
1022525971 7:31037557-31037579 CTCAGAAGAGAGATGGGAGTTGG - Intergenic
1022916398 7:34958909-34958931 CCCAGTAGACAGATGGGCAGTGG - Intronic
1023934597 7:44730385-44730407 CTCAGCCAACAGGTGGGCCAGGG - Intergenic
1024485691 7:49916288-49916310 CTCACCAGCCACAGGGGCCTGGG - Exonic
1024641818 7:51335291-51335313 TACAGAAGACAGATGGGCCTTGG - Intergenic
1026539779 7:71269583-71269605 CTCTGCAGACAGATGAGCAGTGG - Intronic
1026807412 7:73436808-73436830 CCCAGCACACAGATGGACATGGG - Intergenic
1029403142 7:100357610-100357632 CTCAGCAGGAAGATGGGCACTGG + Intronic
1031340511 7:120594603-120594625 CCCAGCATACAGATTGGCATTGG + Intronic
1031786613 7:126041102-126041124 CTCAGCAGAGAGGTGACCCTAGG - Intergenic
1032257954 7:130311873-130311895 CTCAGTTTACAGTTGGGCCTTGG + Intronic
1033555674 7:142486853-142486875 TTCAGTAGACAGAGGGACCTGGG + Intergenic
1034481245 7:151321544-151321566 CTCAGCAGAGAGGAGGCCCTGGG - Intergenic
1034669554 7:152847742-152847764 CTCAGCAGACACAGGGCCCCTGG + Intronic
1035773001 8:2164499-2164521 CTCAGTAGACACAAGGGCCGAGG - Intronic
1036375480 8:8195878-8195900 CTGAGCAGACAGAAAGGACTTGG + Intergenic
1036568149 8:9955903-9955925 CTGAGCAGATAGATGGGAATAGG + Intergenic
1036854052 8:12227271-12227293 CTGAGCAGACAGAAAGGACTTGG - Intergenic
1036875425 8:12469769-12469791 CTGAGCAGACAGAAAGGACTTGG - Intergenic
1038149356 8:24928437-24928459 CTCAGCAGAGAGGAGGTCCTGGG - Intergenic
1039367942 8:36951744-36951766 TTCAGCAGACTCATGGTCCTGGG + Intergenic
1041152977 8:54955512-54955534 CTCAGAGGACAACTGGGCCTTGG + Intergenic
1041888192 8:62837614-62837636 ATCAGCAGACAGATGGGAAATGG - Intronic
1042908432 8:73798867-73798889 CTCAGCATATAGATGGGCTAAGG - Intronic
1043324784 8:79036136-79036158 GACAGCATACAGATGGGTCTTGG - Intergenic
1043490531 8:80743662-80743684 CTCAGCAGAGAGCTGGGGGTGGG + Intronic
1043496012 8:80800882-80800904 CACAGCATACTGATGGGTCTTGG - Intronic
1044672071 8:94692350-94692372 ATCATCAGAGAGCTGGGCCTCGG + Intronic
1044753201 8:95436024-95436046 TTCAGCAGACAGTTGGTCCCTGG + Intergenic
1046707915 8:117476811-117476833 TTCAGAAGACAGATGGCCATAGG - Intergenic
1048356046 8:133654796-133654818 CCCAGCAGGCAGAAGGGACTGGG + Intergenic
1048638547 8:136326785-136326807 TTGAGCTGACAGATGGGCGTGGG + Intergenic
1049211964 8:141391134-141391156 CTCAGCAGCCAGAGGGACCCCGG - Intergenic
1049285754 8:141774350-141774372 CTCAACAGTCAGGTGGGCATGGG - Intergenic
1050115349 9:2257773-2257795 ATCAGCAGACAGGTGCTCCTGGG - Intergenic
1050261509 9:3845875-3845897 CTCTGGAGTCAGATGGTCCTGGG + Intronic
1051160777 9:14204868-14204890 CTCAGAAGACAAAGGGGCTTTGG + Intronic
1051882034 9:21849753-21849775 TACAGAAGACAGATGGGTCTTGG + Intronic
1052194802 9:25698865-25698887 ATTAGCAGAGAAATGGGCCTGGG + Intergenic
1052368535 9:27639929-27639951 TGCAGAAGACAGATGGGTCTGGG + Intergenic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1053281548 9:36823418-36823440 CTCAGCAGAATAATGTGCCTGGG + Intergenic
1053747520 9:41214798-41214820 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1054338863 9:63835727-63835749 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054479765 9:65650570-65650592 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1055744680 9:79429907-79429929 GTCAGGAGAGAGGTGGGCCTAGG - Intergenic
1057927878 9:99169208-99169230 CCCAGAAGACAGCTGGGCTTGGG + Intergenic
1060221656 9:121767290-121767312 CCCAGCACACAGATGGCCCCAGG - Intronic
1060491159 9:124085383-124085405 CTCAGCAGAAAAATTGACCTGGG + Intergenic
1061414327 9:130438224-130438246 CTCTGGAGTCAGATGGACCTGGG - Intergenic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1061451997 9:130672616-130672638 CTCAGGGCTCAGATGGGCCTAGG - Intronic
1061669254 9:132179408-132179430 CGCAGCTGGCAGATGGGCTTAGG - Intronic
1062613382 9:137385149-137385171 CTCTGCAGCCACCTGGGCCTGGG + Intronic
1062724189 9:138062093-138062115 AGAGGCAGACAGATGGGCCTTGG - Intronic
1202783652 9_KI270718v1_random:25569-25591 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1202803423 9_KI270720v1_random:23998-24020 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1203448222 Un_GL000219v1:81221-81243 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1187065089 X:15826621-15826643 CTCAGGAGTCAAATGTGCCTTGG + Exonic
1187361516 X:18632115-18632137 CTCTGCAGACTGGTGGGCTTGGG - Intronic
1190692553 X:52923621-52923643 CACTGCAGTCAGATGAGCCTTGG - Intergenic
1191658927 X:63630887-63630909 TGCAGAAGACAGATGGGTCTTGG - Intergenic
1192184238 X:68935826-68935848 CTCAGAAGTCAGACTGGCCTGGG + Intergenic
1194884068 X:99291069-99291091 TTGAGCAGCCAGATGAGCCTTGG - Intergenic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1196007526 X:110851950-110851972 CTCAGCAGAGGGTGGGGCCTCGG + Intergenic
1197505474 X:127297918-127297940 CTCAGCATTAAAATGGGCCTGGG + Intergenic
1197771361 X:130091682-130091704 CTCATCAGAAAGAAGGTCCTGGG + Intronic
1198641914 X:138765643-138765665 CTCAGCAGTCAGATGGCCTTGGG + Intronic
1199844575 X:151681429-151681451 CTGAGCAGCGAGATGTGCCTTGG - Intergenic
1199850069 X:151719847-151719869 CTCAGGTGACAGGTGAGCCTTGG + Intronic
1199982980 X:152931022-152931044 CTCATCTGAAAGATGGGCATGGG + Intronic
1201579527 Y:15495977-15495999 ACAAGCACACAGATGGGCCTGGG + Intergenic