ID: 987119762

View in Genome Browser
Species Human (GRCh38)
Location 5:14756025-14756047
Sequence GGGGGTATAAAGTGTATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987119762_987119769 14 Left 987119762 5:14756025-14756047 CCTGAAATACACTTTATACCCCC 0: 1
1: 0
2: 2
3: 8
4: 127
Right 987119769 5:14756062-14756084 GCCCAGGTCTGATAAATCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 95
987119762_987119772 18 Left 987119762 5:14756025-14756047 CCTGAAATACACTTTATACCCCC 0: 1
1: 0
2: 2
3: 8
4: 127
Right 987119772 5:14756066-14756088 AGGTCTGATAAATCTTTGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 130
987119762_987119767 -2 Left 987119762 5:14756025-14756047 CCTGAAATACACTTTATACCCCC 0: 1
1: 0
2: 2
3: 8
4: 127
Right 987119767 5:14756046-14756068 CCTCAAAGCCTTAGCAGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987119762 Original CRISPR GGGGGTATAAAGTGTATTTC AGG (reversed) Intronic
900740110 1:4325906-4325928 GGGGGAAGAAAGTAAATTTCTGG + Intergenic
902453193 1:16512409-16512431 GAGGTTATGAAGTGAATTTCTGG - Intergenic
902473247 1:16665079-16665101 GAGGTTATGAAGTGAATTTCTGG - Intergenic
902485556 1:16742363-16742385 GAGGTTATGAAGTGAATTTCTGG + Intronic
902499291 1:16897816-16897838 GAGGCTATGAAGTGAATTTCTGG + Intronic
908415941 1:63913447-63913469 GGGGGTATGCTGTGTATTTTGGG + Intronic
908541716 1:65128542-65128564 GGGCTTATAAATTGTGTTTCTGG - Intergenic
911189858 1:94937185-94937207 GTGGGAATAAAGTGTATTAATGG + Intergenic
911725914 1:101240355-101240377 GGGGGTAGAAAATATATTCCAGG - Exonic
912576901 1:110680396-110680418 GGGAGTTTAAAGTATAATTCTGG - Intergenic
913183092 1:116341829-116341851 GGGGGTTTAACATGAATTTCGGG - Intergenic
916689257 1:167174658-167174680 GGAGGTATAGAGTTTAATTCAGG + Intergenic
917859326 1:179130910-179130932 CGGGGAAAAAAATGTATTTCAGG + Intronic
918858974 1:189796899-189796921 GGGGTTTTAAAGTGTATTGGTGG + Intergenic
919187363 1:194169856-194169878 GGCGGTATTAAGTGTTTTCCTGG + Intergenic
919667334 1:200304737-200304759 GGGGGAAAAAGGGGTATTTCTGG - Intergenic
921206259 1:212851905-212851927 GAGGGTATGGAGTTTATTTCAGG + Intergenic
1068443245 10:57087277-57087299 GAGGGTATGGAGTTTATTTCAGG - Intergenic
1069523237 10:69142998-69143020 TGGGGTAGAAAGTTTGTTTCAGG + Intronic
1075706941 10:124507378-124507400 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075706977 10:124507501-124507523 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075706999 10:124507575-124507597 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075707017 10:124507649-124507671 GGGGGGATAGGGAGTATTTCAGG + Intronic
1075707052 10:124507772-124507794 GGGGGGATAGGGAGTATTTCAGG + Intronic
1078136246 11:8654373-8654395 GGGGCAAGAAAGAGTATTTCAGG - Intronic
1082639316 11:55637258-55637280 GGGGTTAAGAAGTGTATTTCAGG + Intergenic
1086329860 11:85743207-85743229 GGGTGTGTTAAGTGTATTTTGGG - Intronic
1086619737 11:88871585-88871607 GGAGGTAAAAAGAGTATTTATGG + Intronic
1095737988 12:45578456-45578478 GAGGATATAGAGTGAATTTCAGG + Intergenic
1100833443 12:98540843-98540865 GGAGGTATAGAATGTCTTTCTGG + Intronic
1101774850 12:107784316-107784338 GGTGGAATAAAGTGGATTTGGGG + Intergenic
1102112261 12:110373358-110373380 AGGGGAAGAAAGTCTATTTCTGG + Exonic
1106971186 13:35144034-35144056 TGGGGGAAAAAGTGTATTTTGGG + Intronic
1107503454 13:41005583-41005605 GGGGATATAAATTGTAGTACAGG - Intronic
1109387448 13:61650625-61650647 GGGAGTAGACAGTGTATTTCAGG + Intergenic
1110338334 13:74359197-74359219 GTCTGTATAAATTGTATTTCAGG - Intergenic
1110576837 13:77067231-77067253 GGGGGAATAAAGTAAAGTTCAGG - Intronic
1110998504 13:82145139-82145161 GGGGGCATAAAAAGTATTTTTGG - Intergenic
1113717111 13:112518628-112518650 GGAACTATAAAGTGTATTTTAGG - Intronic
1117175967 14:53147122-53147144 GGGGGAGGAAAGTGTATGTCAGG - Intronic
1117208037 14:53465039-53465061 GAGATTATAAAGTGAATTTCTGG + Intergenic
1118861381 14:69666870-69666892 GGGGGCACAAAATGTGTTTCAGG + Intronic
1120661205 14:87253533-87253555 TCTGGTATAGAGTGTATTTCTGG - Intergenic
1121395778 14:93622085-93622107 GAGAGTATAGAGTGTTTTTCAGG - Exonic
1123509556 15:20983039-20983061 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1123566778 15:21556778-21556800 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1123603039 15:21994071-21994093 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1127691677 15:61403031-61403053 GAGTGTATAAAGAGTATATCTGG - Intergenic
1127927444 15:63560657-63560679 GGGGGAATAAAGTCAATTTTTGG + Intronic
1128077390 15:64836159-64836181 GGGGTTATAAAATGCATTTTTGG + Intergenic
1202975139 15_KI270727v1_random:283873-283895 GAGGGTGAAAAGTGGATTTCAGG - Intergenic
1141709863 16:85691977-85691999 GGGGGTACAAGGTTTCTTTCTGG + Intronic
1143193087 17:5054878-5054900 GGGGCTATAAAGTGTGTGACTGG + Intergenic
1145352692 17:22099791-22099813 GGGGGGATATAGTATCTTTCTGG - Intergenic
1145845020 17:28031066-28031088 AGGGGAAGAAAGTGTATTTGAGG + Intergenic
1148036697 17:44668816-44668838 GGGGGTAAAAAATCTACTTCAGG - Intronic
1150675591 17:67244591-67244613 GGGGGAAGAAAGTGAATCTCGGG + Intronic
1156118356 18:33814222-33814244 CTGGGTATAAATTGTATGTCAGG + Intergenic
1157990202 18:52486404-52486426 GAGGCTATAAGGTGTATATCAGG - Intronic
1158377474 18:56887234-56887256 GGGGTTCTGGAGTGTATTTCTGG + Intronic
1159920341 18:74221749-74221771 GGGCCTACAAAGTGTATTTTTGG - Intergenic
1164559292 19:29277571-29277593 GGGGGTTTCAACTGTATTTAGGG - Intergenic
1165239904 19:34457936-34457958 GAGGGAAAAAAATGTATTTCTGG - Intronic
1168453116 19:56481330-56481352 GGAGGTATACAGTTTATTTGTGG + Intergenic
1202705433 1_KI270713v1_random:20138-20160 GAGGTTATGAAGTGAATTTCTGG - Intergenic
929221054 2:39465592-39465614 GGGGGAATAAATTGTATATTTGG - Intergenic
929733869 2:44524668-44524690 AGGGATATAAAAAGTATTTCTGG - Intronic
930231089 2:48844442-48844464 GGAAGTATCAAGTGTTTTTCAGG + Intergenic
930908029 2:56597131-56597153 GGTGGTATACAGTGTATATAAGG + Intergenic
931982668 2:67711145-67711167 GGGTGTCTAAAGTCCATTTCTGG + Intergenic
933180399 2:79220416-79220438 GGTGGTAGAAAGTCTACTTCTGG - Intronic
934583813 2:95470796-95470818 AGGGGTTAAAAGTGTATTTGTGG - Intergenic
934595639 2:95605918-95605940 AGGGGTTAAAAGTGTATTTGTGG + Intergenic
937926907 2:127174691-127174713 GGGGGTAAAAACAGTATTTCAGG + Intergenic
940538330 2:154976352-154976374 GGTGGTATAAAGGGAACTTCTGG + Intergenic
941439737 2:165519682-165519704 GGGGGTATAGGGTGGATTGCTGG + Intronic
942199608 2:173558069-173558091 GGGCTTATTAACTGTATTTCTGG + Intergenic
947119826 2:226801724-226801746 GGGGGTATAGAGTGCCTTACAGG + Intergenic
947126364 2:226873168-226873190 GTGGGCATTAAGAGTATTTCTGG + Intronic
1169425842 20:5496866-5496888 GGGGCTAGAAAGTGTTCTTCTGG - Intergenic
1170205415 20:13792691-13792713 GGGGAAAGAAAGTGTTTTTCTGG + Intronic
1176894602 21:14361658-14361680 TGGGGTATAAAGTGTAGATGTGG - Intergenic
949176885 3:1074404-1074426 GTATGTATAAAGTTTATTTCAGG + Intergenic
949966266 3:9359079-9359101 GGGGATATAAATTCTATTTAGGG + Intronic
955375434 3:58391942-58391964 GGGGAGATACAGTGGATTTCAGG + Intronic
959183905 3:103019088-103019110 GTGTATATAAAGTGTATGTCTGG + Intergenic
959547258 3:107611806-107611828 AGGGGTAGAAAGTTTATTCCAGG - Intronic
960138960 3:114133828-114133850 GGAGGTATGAAGTGAATATCTGG - Intronic
964396759 3:156253928-156253950 GGGGGTATATGATGCATTTCTGG + Intronic
964417750 3:156466093-156466115 GTGGGTATAAAGTTTATTTTAGG - Intronic
966070131 3:175866072-175866094 GTGGGCATAAAGTATATTTTAGG + Intergenic
966225088 3:177589755-177589777 TGGGGTAAAATGTATATTTCTGG + Intergenic
969156081 4:5211093-5211115 GGGGATATAAGAAGTATTTCTGG - Intronic
971300519 4:25438493-25438515 GGGGGCATAAAGTGGGCTTCCGG - Intergenic
972344310 4:38179973-38179995 TGGGATATAAAGAGTATTTGAGG + Intergenic
978795256 4:112702310-112702332 GGGAGTAGACAGTGTATATCTGG + Intergenic
979230605 4:118345182-118345204 GGGGATACAAAGTGTAATGCTGG - Intronic
984151426 4:176137519-176137541 GGTGGTTTAAATTGTATTGCTGG + Exonic
987119762 5:14756025-14756047 GGGGGTATAAAGTGTATTTCAGG - Intronic
987256533 5:16159289-16159311 GTGGGTTTCAAGTGTCTTTCAGG - Intronic
990995198 5:61726275-61726297 GGGGGTAAAAATTAGATTTCAGG + Intronic
991350987 5:65720909-65720931 TGGGTTATAAAGTGTATTAAAGG + Intronic
992046601 5:72897356-72897378 AGGGGAAAAAAGTGTTTTTCTGG - Intronic
995133517 5:108656098-108656120 GGGGGTAAAAAGTGTGTCTTTGG + Intergenic
996455014 5:123671762-123671784 GGGGGTACAAAATGTATTTCAGG - Intergenic
1002431972 5:179208980-179209002 GGGGGTGAAAAGTGTTGTTCTGG - Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1009870529 6:69447673-69447695 GGGGGTAGAAAGCTTATTTAAGG + Intergenic
1010410310 6:75554053-75554075 AGGTGTATTAAGTGTATTTTTGG - Intergenic
1011344215 6:86351305-86351327 GGGGCTATAAAGAGAAGTTCAGG - Intergenic
1013139014 6:107312252-107312274 AGGGGTAGCAAGGGTATTTCTGG - Intronic
1013312731 6:108912403-108912425 GGGTCTATAAAGTTCATTTCTGG + Exonic
1021252703 7:18350974-18350996 GGGGTTATAAAATGTATTTCAGG - Intronic
1022529609 7:31058609-31058631 TGGGCTTTAAAGTCTATTTCAGG + Intronic
1023501134 7:40850492-40850514 AAGGGTATAAAATGAATTTCTGG + Intronic
1023727111 7:43154588-43154610 GGGGGTAAATAGTGTATATTAGG + Intronic
1025815783 7:64909668-64909690 GGGGGTATATAGAGTATTTTTGG + Intronic
1028304182 7:89241408-89241430 GAGGGTAAATAGTGTATTTCAGG - Intronic
1030576246 7:111289659-111289681 GTAGGTATAAAGTTTATTTCTGG - Intronic
1034863140 7:154617303-154617325 GGGGATATAAAATGTATTGTTGG + Intronic
1037305924 8:17503424-17503446 GTGAATATAAAGTGAATTTCAGG - Intronic
1038303271 8:26375739-26375761 GGAGTTAGAAAGTGTAGTTCAGG - Intergenic
1045576825 8:103431316-103431338 AAGGGTATAAAGTTTATTTCAGG + Intronic
1047507431 8:125491058-125491080 GGGTGGATAAGGTCTATTTCTGG - Intergenic
1049712600 8:144072474-144072496 GGAGGTATAAATTGTAGGTCGGG - Intergenic
1050029731 9:1373126-1373148 GGGGCTCCACAGTGTATTTCTGG + Intergenic
1050250559 9:3739604-3739626 GGAAGTACAAAGGGTATTTCTGG + Intergenic
1050438203 9:5631075-5631097 GGGGGAATAAAGTGGTTTACAGG - Intronic
1051779446 9:20673094-20673116 AGGGGGATAAATTGTATTTTGGG + Intronic
1052750374 9:32483868-32483890 GGGGTGATAAGGTGTGTTTCAGG - Intronic
1056436035 9:86576919-86576941 GAGGGAATAAAATGTAGTTCAGG + Intergenic
1056978205 9:91281103-91281125 GAGAGGAGAAAGTGTATTTCAGG - Intronic
1058010229 9:99968877-99968899 GAGGGTATATAATGTATGTCAGG + Exonic
1059927520 9:119225750-119225772 GGGGGTATAGAGTTTGTTTTGGG + Intronic
1186265659 X:7830771-7830793 GAGGTTATAAAGTGTTATTCGGG + Intergenic
1187248559 X:17575865-17575887 GGGGGTATAAAGAAGATTTGGGG - Intronic
1196246887 X:113410644-113410666 GGAGGTCTAAAGTGTATCTATGG - Intergenic
1200051780 X:153436202-153436224 GTGGATATAATGTGTATTTTTGG + Intergenic