ID: 987123738

View in Genome Browser
Species Human (GRCh38)
Location 5:14792077-14792099
Sequence ACGAGGGTGGAGGGCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987123726_987123738 15 Left 987123726 5:14792039-14792061 CCTGTGCTGAAGATGGTGAGGGT 0: 1
1: 0
2: 0
3: 33
4: 179
Right 987123738 5:14792077-14792099 ACGAGGGTGGAGGGCTCTGAGGG No data
987123732_987123738 -8 Left 987123732 5:14792062-14792084 CCTGGATCCTTTGGGACGAGGGT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 987123738 5:14792077-14792099 ACGAGGGTGGAGGGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987123738 Original CRISPR ACGAGGGTGGAGGGCTCTGA GGG Intronic