ID: 987123957

View in Genome Browser
Species Human (GRCh38)
Location 5:14793624-14793646
Sequence ATGGTGGCTGCAAATCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987123953_987123957 -1 Left 987123953 5:14793602-14793624 CCAGGCCGGGAGTCTTGCAGGAA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 987123957 5:14793624-14793646 ATGGTGGCTGCAAATCTCAATGG 0: 1
1: 0
2: 1
3: 15
4: 162
987123955_987123957 -6 Left 987123955 5:14793607-14793629 CCGGGAGTCTTGCAGGAATGGTG 0: 1
1: 0
2: 0
3: 22
4: 155
Right 987123957 5:14793624-14793646 ATGGTGGCTGCAAATCTCAATGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987123957 Original CRISPR ATGGTGGCTGCAAATCTCAA TGG Intronic
904869543 1:33607983-33608005 GTGGAGGCTGCAAACCTCAGTGG + Intronic
905672980 1:39804688-39804710 ATGGTGCCTGCAAAATTCTATGG - Intergenic
911224637 1:95291650-95291672 ATGGTGAGTGCAAATGTCATGGG + Intergenic
912762731 1:112383391-112383413 ATGGTGTTTGCAAATCTTAAGGG + Intergenic
914714188 1:150240448-150240470 ATGGTGGCTGCAACTGGAAATGG - Intergenic
918473047 1:184894665-184894687 ATGCTGCCTCCAATTCTCAATGG + Intronic
923228099 1:231958041-231958063 ATGGTGGCTGGAATTATCAATGG - Intronic
924243307 1:242059886-242059908 ATGGTGGCTGCCATTTTCAGAGG + Intergenic
1062903869 10:1166551-1166573 ACGGTGGCTGCTCATCTCACAGG + Intergenic
1066265329 10:33771326-33771348 AGGGTGGTTCCAAATCTCACAGG - Intergenic
1066703312 10:38152460-38152482 ATGGTGGCTGCAGCTCTCCTAGG + Intergenic
1066987471 10:42480756-42480778 ATGGTGGCTGCAGCTCTCCTAGG - Intergenic
1070834433 10:79439039-79439061 ATGGAGGCTGCAAGCCTCAGTGG - Intronic
1071406052 10:85333737-85333759 TTGGTGGCTGCAATTCTCCCAGG + Intergenic
1074410474 10:113223828-113223850 ATGGTGGCTGAAAAACACAGTGG - Intergenic
1074971875 10:118545573-118545595 ATGGTGGCTGCAGTCCACAAGGG - Intergenic
1075241018 10:120778955-120778977 AAGGAGGATGCAAATTTCAAAGG - Intergenic
1076030107 10:127150094-127150116 AGGGTGTCTCCAAATTTCAAAGG - Intronic
1076434007 10:130427238-130427260 ATGGTGCTCTCAAATCTCAAAGG + Intergenic
1077292716 11:1806006-1806028 ATGTTGGATGGAAATCTCCAGGG - Intergenic
1078515479 11:12018295-12018317 AAGGTGACTGGAAATCTTAAAGG - Intergenic
1084791008 11:71475119-71475141 ATGGAGCCTGCTAATTTCAAAGG - Intronic
1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG + Intergenic
1086191832 11:84088790-84088812 ATGTATGATGCAAATCTCAATGG - Intronic
1086846629 11:91757928-91757950 TTGATGGCTGCAAATATCAGAGG - Intergenic
1086921691 11:92594798-92594820 ATTTTGGCAGCAAATATCAAGGG - Intronic
1087943658 11:104131695-104131717 TTGGTGGCAGCAAATCTTCAAGG - Intronic
1088827613 11:113508931-113508953 ATGGTGCCTGCTATACTCAAGGG - Intergenic
1096161881 12:49385796-49385818 ATTGTAACTGCAAACCTCAAGGG - Intronic
1098006296 12:66000097-66000119 ATGGTGGCTTCATATCTAGAAGG + Intergenic
1101465222 12:104941791-104941813 ATGGGTGCAGCAAATCACAATGG + Intronic
1101829747 12:108248278-108248300 ATGGTGGATGCAGCCCTCAAAGG + Exonic
1102223533 12:111211372-111211394 CTGGTGGGTGCAAATCTGACAGG - Intronic
1102851349 12:116248444-116248466 AGAGTGGCTTCAAATATCAAAGG + Intronic
1105974441 13:25460878-25460900 AAGATGGCTGCCAGTCTCAATGG - Intronic
1106192787 13:27468583-27468605 ATGGTACCTGCCAATCTCCATGG - Intergenic
1113410980 13:110089633-110089655 ATTGAGGCAGCAAATCTCCAAGG - Intergenic
1117402957 14:55374003-55374025 ATTGTGTGTGCAATTCTCAATGG + Intronic
1119091639 14:71787770-71787792 ATAGTGGCTTCAAATCTTCAAGG + Intergenic
1119258813 14:73224470-73224492 ATGATGCCTCCAATTCTCAAAGG - Intergenic
1121152342 14:91647115-91647137 ATCAGGGCTGCAAATCTCACAGG + Intronic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124593751 15:31077106-31077128 ATGGTGGATGCAAGTCTTTAAGG + Intronic
1125146874 15:36480754-36480776 ATGGTGCCAGCAAAATTCAAGGG - Intergenic
1125391025 15:39193144-39193166 ATGGTGCCTGCATGTTTCAAAGG + Intergenic
1128140367 15:65295975-65295997 ATGGTGTCTACTAATCCCAAGGG - Intronic
1128487092 15:68103522-68103544 ATGGTGGCTGCACAACTCTGTGG - Intronic
1131723265 15:95194921-95194943 ATGTTGCCTGCAAATTTCAAGGG + Intergenic
1133051767 16:3120942-3120964 ATGGTGGGAGCAAATGGCAAAGG - Intergenic
1134820764 16:17245298-17245320 TTGGTCGCTGCAAATATCACCGG + Intronic
1136174196 16:28506290-28506312 CTGGTGGCTGCAGAACTCAGGGG - Intronic
1137408394 16:48207810-48207832 ATGGGGGGTTCAAATCTCAAGGG + Intronic
1137781604 16:51102364-51102386 AAGGTGTCTGCTAATCTGAAGGG - Intergenic
1139069072 16:63358169-63358191 ATGGAGGTTGCACATCTAAATGG + Intergenic
1139784615 16:69382437-69382459 ATTGTGGTTGCCAACCTCAAAGG + Intronic
1140133415 16:72183900-72183922 CTGGTGGCAGCAACTCTGAATGG + Intergenic
1149641492 17:58205845-58205867 ACAGTGGCTGCAAATATAAAGGG + Exonic
1150803667 17:68301927-68301949 ATGGAGGCTGCAAAGTTAAAGGG - Intronic
1155404961 18:25477731-25477753 TTCCTGGCTGCCAATCTCAATGG + Intergenic
1156078042 18:33304290-33304312 TTGTTGGCAGCAATTCTCAAGGG + Intronic
1156543388 18:37939503-37939525 ATGGTTGCAGCAAACCACAATGG - Intergenic
1156799920 18:41097974-41097996 ATGGTGTCTTCAAACCCCAAAGG + Intergenic
1157567114 18:48686789-48686811 ATGGAGGCTGCAAATCTCCGAGG - Intronic
1157910053 18:51608657-51608679 ATTGTGGTTGTATATCTCAAAGG - Intergenic
1158663717 18:59413335-59413357 ATGGTGGCTCCAAATAACAAGGG + Intergenic
1158951408 18:62498828-62498850 GTGGTGGCTGCCAAAATCAATGG + Intergenic
1159257232 18:65962671-65962693 ATGCTTGCTGGAAAGCTCAATGG + Intergenic
1159555006 18:69936407-69936429 ATGGTCACTGCACTTCTCAAGGG - Intronic
1160074784 18:75663652-75663674 ATGGAGGCTGAAAATCCCAGGGG - Intergenic
1160530765 18:79560937-79560959 CTGGTGGCATCAAATCTCCAGGG - Intergenic
925383666 2:3446862-3446884 GTGATGGCTGCAAACCTAAAAGG - Intronic
927076084 2:19579355-19579377 ATCATGTCTGCAACTCTCAAAGG - Intergenic
927418058 2:22899986-22900008 AGGGAGGCTGCAAATTTCAAAGG - Intergenic
928710927 2:34004860-34004882 CTAGTGCCTGCAAATCTAAACGG - Intergenic
931729199 2:65138124-65138146 ATGGTAGCTTTACATCTCAAAGG + Intergenic
934121415 2:88843824-88843846 TTGGTGGCTGCAGCTCTGAACGG + Intergenic
940932439 2:159449573-159449595 ATGGTAGCTGCCAGTCTCAAAGG + Intronic
943670039 2:190649715-190649737 AAGGTGGCTGCAAAACTCTGGGG - Intronic
944279121 2:197874130-197874152 ATGACGGATTCAAATCTCAATGG + Intronic
944455772 2:199892635-199892657 ATGGGTGCAGCAAATCACAATGG + Intergenic
945317760 2:208389418-208389440 ATGGTGTCTGCAAATATAACTGG - Intronic
947074122 2:226323235-226323257 ACAATGGCTGCATATCTCAAAGG + Intergenic
947711579 2:232319470-232319492 TTGGTGGCTGCACAGCTCAGCGG + Intronic
1170782066 20:19434826-19434848 ATGGTGACTGCTAACCTGAAGGG + Intronic
1175803158 20:61812527-61812549 ATGGTGGCTGAAATTCTCTCGGG - Intronic
1176510957 21:7747671-7747693 AAAGTGGCTGAAAATTTCAAAGG - Intronic
1178645070 21:34378200-34378222 AAAGTGGCTGAAAATTTCAAAGG - Intronic
1178701363 21:34835948-34835970 ATGATGGCTGCAAATCTCCATGG + Intronic
1179312426 21:40208477-40208499 AAAGTGGCAGCGAATCTCAAAGG + Intronic
1182455603 22:30448296-30448318 CTGGTGGCTTCAGATCTCATTGG - Intronic
1184424946 22:44403875-44403897 ACGGGGGCTGCAACTCTCAGAGG + Intergenic
949118628 3:358911-358933 ATGTTAGCTGGAAATGTCAAGGG - Intronic
949317409 3:2772124-2772146 TTGGTGGCTGACGATCTCAAAGG + Intronic
949329187 3:2902291-2902313 CTGGTGGCGGCCAATCTGAAGGG - Intronic
949467489 3:4358917-4358939 ATGCTGGCTGCAAATGCCAGTGG + Intronic
950866617 3:16194904-16194926 ATGGTGGCAGCAAACCACTATGG + Intronic
953981448 3:47415157-47415179 ATTGTGGCTGCACGGCTCAACGG - Exonic
954466207 3:50656491-50656513 ACGGTGGATGCAAAGCTCATTGG + Intergenic
957012503 3:75024375-75024397 ATGGGGGCAGCAAACCACAATGG - Intergenic
958578476 3:95985095-95985117 ATTGTGGCTGAAAACCTCATGGG + Intergenic
962023275 3:131522359-131522381 TTTGTGGCTGAAAATTTCAATGG + Intergenic
963297795 3:143565649-143565671 ATAGTGCCTACAATTCTCAAGGG - Intronic
963864974 3:150350820-150350842 ATGGTCTCTGCAAATCTCATTGG - Intergenic
964638894 3:158887020-158887042 AAGGTGGCCTCAAAGCTCAAAGG - Intergenic
969185339 4:5470279-5470301 AGGCTGACTGCAAATCTCAGGGG - Intronic
971620330 4:28847927-28847949 ATGGTGGCTGCATAGGTCATTGG + Intergenic
974955843 4:68640318-68640340 ATGGGTGCAGCAAATCACAATGG - Intronic
975276012 4:72502798-72502820 ATGGGTGCAGCAAACCTCAATGG - Intronic
976702495 4:87986423-87986445 ACGGTGACTGCAAATCTCTCTGG - Intergenic
977662524 4:99607442-99607464 TTGGTGGCTGCAAATCATGATGG + Intronic
978393839 4:108256757-108256779 CTGCTGGCTGCACATCTGAACGG + Intergenic
978896890 4:113899608-113899630 ATGCTGGCAGCAAATCACTAGGG - Intergenic
980373962 4:131918240-131918262 ATGGTTGCTGCAAGTCTCACTGG + Intergenic
982756190 4:159221230-159221252 GTGGTGGCTGCAAAGGTGAAAGG + Intronic
985378468 4:189367181-189367203 ATGGTGCCTGCACATATTAAAGG + Intergenic
985763748 5:1765525-1765547 CTGCTGGCTGCACATCTCACGGG + Intergenic
986528413 5:8706471-8706493 ATGGTGGCAGAAAACCTCAGAGG + Intergenic
986915403 5:12613543-12613565 ATGGTGGCTGCCCATCCCCATGG + Intergenic
987123957 5:14793624-14793646 ATGGTGGCTGCAAATCTCAATGG + Intronic
987422148 5:17733045-17733067 ATGGTGTCTGCAATTCACACTGG - Intergenic
988005768 5:25408295-25408317 ATGGTGGCAGCAAACCACCATGG - Intergenic
988604929 5:32670829-32670851 ATAAAAGCTGCAAATCTCAAGGG + Intergenic
988717145 5:33839538-33839560 ATGGTGGCTCCAACTCTGGAAGG + Intronic
991181502 5:63756555-63756577 ATGGTTGGTGCAAATCATAAGGG - Intergenic
993916813 5:93754131-93754153 ATGGTTACTGTAAATCTTAAAGG + Intronic
997058214 5:130469845-130469867 ATGGTGGCTGCAAAGGGCTAGGG + Intergenic
998844075 5:146288516-146288538 ATGGTGGAAGTAAATCCCAAAGG - Exonic
1000383001 5:160645675-160645697 AAGCTTGCTGAAAATCTCAAAGG - Intronic
1000719854 5:164693195-164693217 ATGGTGGCTGCCCATCTCCCTGG - Intergenic
1000880777 5:166694316-166694338 ATGGTACCTGCCAATCTCAACGG + Intergenic
1007017609 6:38484550-38484572 AGGGTTGCTACAAATGTCAAAGG - Intronic
1008593748 6:53020356-53020378 AATGTGGCTCCAAATCTCAATGG + Intronic
1008776660 6:55047548-55047570 AAGGTGGCAGCAAATGTCACAGG + Intergenic
1009039802 6:58162533-58162555 AGGCTTGCTGCAAATCTAAAGGG - Intergenic
1009215698 6:60917380-60917402 AGGCTTGCTGCAAATCTAAAGGG - Intergenic
1012405889 6:98897640-98897662 ATGGAGGCTGGGAATTTCAAGGG + Intronic
1013954253 6:115822046-115822068 ATCATGAATGCAAATCTCAAAGG - Intergenic
1016277749 6:142374498-142374520 ATGGTGGCTGCTGCTTTCAAAGG + Intronic
1016789427 6:148052361-148052383 ATGGTGGCTGACATTCTCAGGGG + Intergenic
1016792134 6:148077118-148077140 ATGGGGGCTGCAAATGCCACTGG + Intergenic
1017178589 6:151528028-151528050 AGGGTGGTTTCAAAGCTCAATGG - Intronic
1020946488 7:14614962-14614984 ATGGTGGCTGCGGATTGCAATGG + Intronic
1022879798 7:34574616-34574638 ATGGTGGCTGGTCATCTTAATGG + Intergenic
1023169586 7:37377722-37377744 ATGGTGGCTGAATTTCTCAGAGG - Intronic
1026805716 7:73428927-73428949 ATGGTGGCTGCAAGGCACAGAGG + Intergenic
1028104710 7:86863434-86863456 ATGGAGGCTGAAAGTCTGAAAGG + Intronic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1030830192 7:114210773-114210795 ATGGCGGCTGCCACTCTCCATGG + Intronic
1033033977 7:137853647-137853669 ATGTTCCCTGCAAATCTAAATGG - Intergenic
1038073223 8:24041406-24041428 ATGGTGGCTGCCAGTGTCTAGGG - Intergenic
1043655094 8:82654134-82654156 TTGGTGGATGCACTTCTCAAGGG - Intergenic
1044219605 8:89654042-89654064 CTGGAGGCTGCAATTCTGAAGGG - Intergenic
1044428744 8:92084159-92084181 ATGGTTGCTGCAAACCACCATGG + Intronic
1044618135 8:94163285-94163307 ATGGTGGCTGCAGAGGGCAAAGG - Intronic
1045222951 8:100216219-100216241 ATGTTGGCTGCAAATCACCACGG - Intronic
1046386907 8:113517910-113517932 ATGGGGACAGCACATCTCAAGGG + Intergenic
1047294109 8:123556130-123556152 TTGGTTACTGCAAATCCCAAAGG - Intergenic
1047510388 8:125511403-125511425 ATGGTGGCTGCAAATTAAAGAGG + Intergenic
1048003369 8:130397835-130397857 CTGGTGGCTGGTAATCTGAATGG + Intronic
1048953419 8:139514585-139514607 AAGGAGGCTGTAAATCTCAAAGG - Intergenic
1049653063 8:143784555-143784577 ATGCAGTCTCCAAATCTCAATGG + Intergenic
1052435291 9:28419883-28419905 AAGGTGGCTGCCAATATAAAAGG + Intronic
1053408869 9:37902889-37902911 AGGGTGACTCCAATTCTCAAAGG + Intronic
1055830939 9:80378077-80378099 ATTGTGGTTTCAAAACTCAAAGG + Intergenic
1058707922 9:107652536-107652558 GTGGTGGCTGCCAATCTCCTTGG + Intergenic
1059399024 9:114057215-114057237 TTGGTGTCTGCACATCTGAACGG - Intergenic
1060430943 9:123551197-123551219 AAGGTGTCTGCAAATCACAAGGG - Intronic
1060536037 9:124388916-124388938 ATGGAGGCTGCAGATATGAAAGG - Intronic
1187450092 X:19388329-19388351 AGGGTGGCTGGAAAAGTCAAAGG + Intronic
1189180952 X:39004063-39004085 GTGGTGGGGGCAAATCTCCATGG + Intergenic
1189450549 X:41124926-41124948 ATGCTGGCCGCAAAACTCATAGG + Intronic
1193003785 X:76592582-76592604 ATGGGTGCAGCAAATCTCTATGG - Intergenic
1193264756 X:79455074-79455096 ATGGTTGCAGCAAATCACCATGG + Intergenic
1194352238 X:92834770-92834792 ATGATGCCAGCAAATCTCAGAGG - Intergenic
1195026720 X:100884800-100884822 AAGGTGTCTGCAACTCACAAGGG + Intergenic
1196555318 X:117078469-117078491 ATGGGGGATGAAACTCTCAAAGG - Intergenic
1200660548 Y:5951508-5951530 ATGATGCCAGCAAATCTCAGAGG - Intergenic
1201758864 Y:17517211-17517233 ATGGTGGCTGCCATTTTCAGGGG - Intergenic
1201842691 Y:18388779-18388801 ATGGTGGCTGCCATTTTCAGGGG + Intergenic