ID: 987127382

View in Genome Browser
Species Human (GRCh38)
Location 5:14827077-14827099
Sequence CCCAGGTCGGTGAGGTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987127382_987127386 -7 Left 987127382 5:14827077-14827099 CCAAGGAACCTCACCGACCTGGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 987127386 5:14827093-14827115 ACCTGGGCTAAGCAGCTGAGCGG No data
987127382_987127388 12 Left 987127382 5:14827077-14827099 CCAAGGAACCTCACCGACCTGGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 987127388 5:14827112-14827134 GCGGTCACCACTGTGCGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987127382 Original CRISPR CCCAGGTCGGTGAGGTTCCT TGG (reversed) Intronic
900125762 1:1068403-1068425 CCCAGGTGGCTCAGGTGCCTGGG - Intergenic
900376084 1:2355512-2355534 ACCAGCTGGGTGAGGTTTCTGGG + Intronic
902081535 1:13824170-13824192 CCCAGTTCAGTGAGGTTCTTGGG + Exonic
902630696 1:17702764-17702786 CACAGGTCTGTGAGTGTCCTGGG - Intergenic
903014907 1:20355471-20355493 CCCAAGCTGGTGGGGTTCCTTGG - Intergenic
904486403 1:30827338-30827360 CCCAGGCCTGTCAGGTTCCAAGG + Intergenic
904575276 1:31501447-31501469 CCCAGGGCGATGAGCTTCTTTGG - Intergenic
906066030 1:42980718-42980740 CTCTGGTTGATGAGGTTCCTGGG - Intergenic
906639952 1:47435823-47435845 CCTAGGTATGTGAGTTTCCTTGG + Intergenic
911132154 1:94399973-94399995 CCCAGGAGTGGGAGGTTCCTGGG + Intergenic
918267527 1:182858806-182858828 ACCAAGTGGGTGTGGTTCCTTGG + Exonic
920412816 1:205775255-205775277 TCCCGGTGGGTGAGGTTCCGCGG - Exonic
921325798 1:213985427-213985449 CCCAGCTCCGTGAGCTGCCTCGG - Intronic
921441517 1:215191825-215191847 GCCAGGTCGGTGGGGAACCTAGG + Intronic
924774787 1:247108535-247108557 CCCAGGTCGGTGGAGTTGCTTGG - Intergenic
1063286077 10:4689827-4689849 CTCAAGTCAGTGAGGGTCCTGGG - Intergenic
1063900355 10:10726497-10726519 GGCAGGTCGGTGAGGTACCTTGG - Intergenic
1063916875 10:10892303-10892325 CCCAGGTGGGTGAGTGACCTTGG - Intergenic
1067227182 10:44383920-44383942 CTCAGGCCGCTGAGCTTCCTTGG - Intronic
1071470106 10:85978055-85978077 CCCAGGTATGTGAGGATCCCTGG - Intronic
1075832572 10:125423864-125423886 CCCAGAAGGGTGAGGTTCCTGGG + Intergenic
1079931750 11:26572224-26572246 AGCAGGTCAGTCAGGTTCCTGGG - Intronic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1081571697 11:44295474-44295496 CCTAGGCCGGGGAAGTTCCTAGG + Intronic
1084485218 11:69444081-69444103 CTCGGGTCTGTAAGGTTCCTGGG + Intergenic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1088832176 11:113546864-113546886 CCAAGGGTGGTGAAGTTCCTGGG - Intergenic
1089739378 11:120571794-120571816 CCCAGGTCTGTGAGGTGACCTGG + Intronic
1094061537 12:26319659-26319681 CCCAGGCCGGAGAGCCTCCTGGG - Intergenic
1094499143 12:31007423-31007445 CCCAGGTCAGTGAGGAGCCAAGG - Intergenic
1095476793 12:42593829-42593851 CCCAGGTCTGTTTGATTCCTAGG + Intergenic
1096649279 12:53054010-53054032 CCCAGGTAAGTGAGGGTGCTGGG + Exonic
1101576894 12:106006123-106006145 CACAGGTAGGTCAGGGTCCTAGG - Intergenic
1111195983 13:84874803-84874825 CCCAGGTCGGTGGAGTTGCTTGG - Intergenic
1112494359 13:99893742-99893764 CCCAGGTCTGTAGGGCTCCTTGG - Exonic
1113586332 13:111468484-111468506 GCCGGGCCGGTGAGGGTCCTGGG - Intergenic
1114583244 14:23784774-23784796 CCCAGGTCCATGAGATACCTGGG + Intergenic
1119998484 14:79278516-79278538 CCCAGGTGGGTGAAGTCCCCTGG - Intronic
1121219422 14:92274705-92274727 CCCAGGTGAGCCAGGTTCCTGGG - Intergenic
1121741672 14:96257187-96257209 CCCAGGACGGGGAGGTGGCTGGG - Intronic
1122082289 14:99274301-99274323 CCCAGGAAGGTGAGGGTCGTGGG - Intergenic
1123906245 15:24924416-24924438 CCCTGGTTAGTGAGTTTCCTGGG + Intronic
1126119293 15:45236975-45236997 CACAGGTCGGTGGAGTTGCTTGG + Intergenic
1128244640 15:66124953-66124975 CCCAGGTCAGTGAGCCTTCTGGG - Intronic
1130697161 15:86142131-86142153 CCCAGGTCACAGAGGTGCCTGGG - Intronic
1132550212 16:551040-551062 CCCCGGTCGGTGAGGGTCCCCGG + Intronic
1132550232 16:551089-551111 CCCCGGTCGGTGAGGGTCCCCGG + Intronic
1132616207 16:842223-842245 CCCGGGTCTGTGGGGCTCCTGGG + Intergenic
1132877582 16:2147225-2147247 CCCAGCTCTGCCAGGTTCCTGGG + Intronic
1135076224 16:19396063-19396085 CCCAGGTCAGTGGAGTTGCTTGG + Intergenic
1143614377 17:8040785-8040807 CCCTGGAGGGTGAGTTTCCTGGG - Intronic
1143921164 17:10332050-10332072 CCCAGGGCTGTGGGGTTACTAGG + Intronic
1144464369 17:15485209-15485231 CCCTGGTTGATGAGATTCCTGGG - Intronic
1147972559 17:44227322-44227344 CCCAGGCCTGTGAGGTAACTGGG - Intergenic
1148141684 17:45333558-45333580 CCCAAGTGGGTGAGATTCCCAGG - Intergenic
1149193830 17:54095617-54095639 CCCTGGTTGATGAGATTCCTGGG + Intergenic
1149664678 17:58357553-58357575 CCCAGGTGGATGTGGTTCCAGGG + Exonic
1151222184 17:72621301-72621323 CCCAGGTTTGAGAGGTTTCTTGG - Intergenic
1153737216 18:8083330-8083352 AGGAGGTCGGTGTGGTTCCTTGG - Intronic
1156526822 18:37775632-37775654 TCCAGGTGGGTGAGGAGCCTTGG + Intergenic
1157885885 18:51365845-51365867 CCGAGGTCTGGAAGGTTCCTAGG - Intergenic
1158406431 18:57163972-57163994 CCCAGGTTTGTCTGGTTCCTAGG - Intergenic
1160407837 18:78655212-78655234 CCCAGGACCGAGGGGTTCCTGGG - Intergenic
1161274798 19:3409846-3409868 CCCAGGTCTGTGAGGTGTCATGG - Intronic
1161326417 19:3666196-3666218 CCCAGGTGGGACAGGTGCCTTGG + Intronic
1161400223 19:4064047-4064069 GCCTGGTCGGAAAGGTTCCTGGG - Intronic
1162246585 19:9406681-9406703 CCCTGGTCGGTGAAGCTGCTGGG + Intergenic
1162540276 19:11291446-11291468 CCCAGGAGGGTGAGGTTGCAGGG + Intergenic
1164384735 19:27763066-27763088 CCTAGGCAGGTGAGATTCCTGGG - Intergenic
1164533171 19:29063391-29063413 GACAGCTCGGTGACGTTCCTTGG - Intergenic
1164673181 19:30084714-30084736 CCCAGGGCTGTGGGCTTCCTTGG + Intergenic
1166073203 19:40398406-40398428 CCGAGGTGGGTGAGGGCCCTGGG + Intronic
1166161558 19:40957457-40957479 CCCAGGTCAGTGGAGTTGCTTGG - Intergenic
928462349 2:31486232-31486254 CCCAGGTCTCTAAGGCTCCTAGG + Intergenic
930108570 2:47658763-47658785 CCCTGGTTGATGAGATTCCTGGG + Intergenic
930493410 2:52106671-52106693 CCCAGGTCAGTTAGGTTCTGAGG + Intergenic
931446095 2:62328404-62328426 CCCTGGTGGATGAGATTCCTGGG + Intergenic
931636303 2:64343685-64343707 CCCAGGATGGTGAGGTTCCTGGG + Intergenic
933419566 2:82028761-82028783 CCCAGGTCAGTGGAGTTCCATGG - Intergenic
933719882 2:85391108-85391130 CCCATGCCGGTGAGGGTACTTGG - Exonic
936011408 2:108927577-108927599 CATAGGTCGGCGAGGTTCCGTGG + Intronic
936410965 2:112257812-112257834 GCCATGTGGGTGAGGTACCTTGG + Intergenic
937932997 2:127220035-127220057 GCCAGGTTGGCGAGGGTCCTCGG + Intronic
942047587 2:172108750-172108772 CACAGGTGGGTGAGCTTCCAAGG + Intergenic
943261716 2:185673117-185673139 CCCTGGACAGTGAGTTTCCTTGG - Intergenic
947911584 2:233804184-233804206 ACCTGGAAGGTGAGGTTCCTGGG + Exonic
948707483 2:239804192-239804214 CCCAGGTGTGTGAAGTCCCTCGG + Intergenic
1169305033 20:4482399-4482421 CCCAGGTCTGTGGGGCTCTTAGG + Intergenic
1169381752 20:5113296-5113318 CCCAGGTAGGTGAGGACCCTAGG - Intergenic
1171275722 20:23855354-23855376 TCCAGATCTGTGAAGTTCCTTGG - Intergenic
1171962576 20:31505307-31505329 CCCAGATCTGTGAGCTTCCTTGG - Intergenic
1173248788 20:41353736-41353758 GCCAGGTCAGTGTGGTGCCTTGG - Intronic
1173316411 20:41948703-41948725 CCCAGGTTGGTGAAGTCCCGAGG - Intergenic
1175515464 20:59567223-59567245 CCCAGGGCAGTGTGGCTCCTTGG + Intergenic
1175636793 20:60591255-60591277 CCCAGGGAGGTGAGGTTCTGAGG - Intergenic
1175733641 20:61370952-61370974 CCCAGAGCGCTGAGGCTCCTCGG - Intronic
1179651084 21:42809253-42809275 CCAAGTTCGGTGAGGTCCCCGGG + Intergenic
1179726838 21:43345676-43345698 CCCAGGTCGAAGAGGCTCCCAGG - Intergenic
1180055797 21:45358585-45358607 CCCAGGTAGGCGAGGGGCCTGGG + Intergenic
1181256853 22:21568171-21568193 CCCAGGGCGGGGCGGTTCCGCGG - Intronic
1181348997 22:22241987-22242009 CCCAGTTCTGTGAGTTGCCTGGG - Intergenic
1182427471 22:30282582-30282604 CCCAGGTGGGTGAGGCTGCTGGG - Intergenic
950613352 3:14139941-14139963 CCCAGGAGGATGGGGTTCCTCGG + Intronic
950798959 3:15533942-15533964 CCCAGGAATGTGAGGTTCCAGGG + Intergenic
953897480 3:46813247-46813269 CCCAGGCCTGTGAGGTAACTGGG + Intergenic
955955756 3:64287841-64287863 CCCTGGTTGGTGAGATTCCCTGG - Intronic
957911267 3:86622333-86622355 CCAAGGAAGGTGAGTTTCCTGGG - Intergenic
957988944 3:87607057-87607079 CCCTGGTTGATAAGGTTCCTGGG + Intergenic
961843490 3:129738892-129738914 CCCAGGTGGCGGAGGTTGCTGGG - Intronic
962936776 3:140088663-140088685 TCCATGTCACTGAGGTTCCTCGG + Intronic
963938501 3:151078081-151078103 ACCAGGTGGCTGAGGTTCCAGGG + Intergenic
964980375 3:162670319-162670341 CCCAGGTGGGAGAGGGTCCCTGG + Intergenic
967919242 3:194602251-194602273 CCCAGGCCGCTGTGGCTCCTGGG + Intronic
968913268 4:3486288-3486310 CCCAGGTCGGGGCGGGTGCTGGG + Intronic
969619397 4:8271442-8271464 CCCAGCACGCTGGGGTTCCTGGG + Intronic
970596660 4:17606412-17606434 CCCAGGACGGGGAGGTTGCAGGG - Intronic
971964240 4:33531028-33531050 GCCAGGTAAGTGAGTTTCCTTGG + Intergenic
973612360 4:52648185-52648207 GTCTGGTCGGTGAGCTTCCTTGG - Intronic
977488139 4:97675420-97675442 CCCAGGTCGGTGGATTTCCAGGG - Intronic
978429663 4:108620462-108620484 CCCACGTCGGAGAGGTGCGTCGG + Intergenic
983660485 4:170126494-170126516 CCCAGGTCAGTGGAGTTGCTTGG + Intergenic
985055320 4:186030995-186031017 CCCAGGTTGATGAGATTCCCAGG - Intergenic
987127382 5:14827077-14827099 CCCAGGTCGGTGAGGTTCCTTGG - Intronic
990328999 5:54706954-54706976 CCCAAGTGGGTGAGGGGCCTGGG - Intergenic
998025815 5:138815364-138815386 TCCAGGCAGGTTAGGTTCCTGGG - Intronic
1004643073 6:17534454-17534476 CCCATCTCAGTCAGGTTCCTGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006783581 6:36649743-36649765 CCCAGGTCAGTGTGCTTCCCTGG - Intergenic
1006918841 6:37614509-37614531 CCCAGGTTGGTGGGGTTCTAAGG - Intergenic
1009650823 6:66475924-66475946 TGTAGGTCGCTGAGGTTCCTTGG + Intergenic
1011315684 6:86028234-86028256 CCCAGGACTATGAGCTTCCTAGG + Intergenic
1018857637 6:167685905-167685927 CCCAGGCCGGTGAGGTGCACTGG - Intergenic
1019129548 6:169863380-169863402 CCAAGGTCGCTGTGGTACCTGGG + Intergenic
1024217221 7:47257471-47257493 CCCAGGTGGGTGAGGCTGCGAGG - Intergenic
1024256968 7:47546481-47546503 CCCAGGACGGTGAGGTGCTGAGG + Intronic
1025109030 7:56197231-56197253 CCCAGGTCTGTGGAGTTCGTGGG - Intergenic
1025740151 7:64188334-64188356 CTCAGGCAGGTGAGGCTCCTGGG - Intronic
1029465231 7:100720946-100720968 CCCAGGTCGCTGAGGGACCCCGG + Exonic
1035028667 7:155843683-155843705 GCCAGGGCTGTGGGGTTCCTGGG + Intergenic
1035060131 7:156062930-156062952 CCCAGGTCCGGGACGGTCCTCGG + Intergenic
1035325682 7:158064477-158064499 CCCAGCGCTGTGAGGTTGCTTGG + Intronic
1037620763 8:20561636-20561658 TCCTGGTCGGTGGGGTTGCTTGG - Intergenic
1037777696 8:21846617-21846639 CCCAGGCCGGTGGTGTTGCTGGG + Intergenic
1040138690 8:43884967-43884989 CTCAGGTCGGTGGAGTTACTTGG + Intergenic
1042282010 8:67064867-67064889 CCGGGGTCGGGGAGGTTCCCTGG + Intronic
1042657467 8:71115591-71115613 ACCAGGTCAGTGAGCTTCCCTGG - Intergenic
1046374232 8:113354870-113354892 CCCAGGTCGGTGGAGTGCTTGGG - Intronic
1046698409 8:117371187-117371209 CCCACGTATGTGTGGTTCCTTGG + Intergenic
1048848967 8:138626404-138626426 CCCAAGGCAGTGAGGTTCCCTGG + Intronic
1049876957 8:145030229-145030251 CCCAGGTCGGTGGAGTTACTTGG - Intergenic
1052741231 9:32394877-32394899 ACCAGGTTGGTGAGGTGGCTGGG + Intronic
1053267388 9:36725088-36725110 CCCTGGTCTGAGGGGTTCCTGGG - Intergenic
1057652932 9:96933317-96933339 CCCAGGTCAGAGAGGGTTCTTGG + Intronic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1189284966 X:39845582-39845604 CCCAGGTGGGGGAGGCTCCCTGG + Intergenic
1191741058 X:64435296-64435318 CCCAGGCCTGTGAGGTAACTGGG + Intergenic
1194055748 X:89128802-89128824 CCCAGGTGGGGGAGTTCCCTTGG + Intergenic
1195945772 X:110209777-110209799 CCCAGCTCTGTGAGCTTTCTGGG - Intronic
1199247580 X:145624987-145625009 CCCAGGTTGGTGAGGTTTGCAGG - Intergenic
1200061796 X:153487092-153487114 CCCATGTCCGTGCGGTTCCTGGG + Intronic
1200085121 X:153600233-153600255 CCCAGCTGGGTTAGTTTCCTGGG + Intergenic
1200254548 X:154573124-154573146 CCCAGGTCGGCCAGCGTCCTCGG - Intergenic
1200263221 X:154631284-154631306 CCCAGGTCGGCCAGCGTCCTCGG + Intergenic
1200683038 Y:6235491-6235513 CCCAGGTCCTAGAGGTCCCTTGG - Intergenic
1200982615 Y:9276181-9276203 CCCAGGTCGGTGGAGTTGCTTGG + Intergenic
1201049595 Y:9918891-9918913 CCCAGGTCCTAGAGGTCCCTTGG + Intergenic
1202127780 Y:21583520-21583542 CCCAGGTCGGTGGAGTTGCTTGG - Intergenic
1202162392 Y:21948864-21948886 CCCAGGTCCTAGAGGTCCCTTGG + Intergenic
1202228964 Y:22637509-22637531 CCCAGGTCCTAGAGGTCCCTTGG - Intergenic
1202314190 Y:23558656-23558678 CCCAGGTCCTAGAGGTCCCTTGG + Intergenic
1202556612 Y:26111939-26111961 CCCAGGTCCTAGAGGTCCCTTGG - Intergenic