ID: 987128007

View in Genome Browser
Species Human (GRCh38)
Location 5:14833425-14833447
Sequence CCTAACAAGCTCTGCAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987128007_987128011 2 Left 987128007 5:14833425-14833447 CCTACCCTGCAGAGCTTGTTAGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 987128011 5:14833450-14833472 CTCAGACATATCAATCTTTATGG No data
987128007_987128013 20 Left 987128007 5:14833425-14833447 CCTACCCTGCAGAGCTTGTTAGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 987128013 5:14833468-14833490 TATGGCATTTAGAGCACAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 146
987128007_987128012 17 Left 987128007 5:14833425-14833447 CCTACCCTGCAGAGCTTGTTAGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 987128012 5:14833465-14833487 CTTTATGGCATTTAGAGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987128007 Original CRISPR CCTAACAAGCTCTGCAGGGT AGG (reversed) Intronic
900131104 1:1087706-1087728 ACTAACATGCTCTGGAGGGTAGG + Intronic
900956546 1:5889631-5889653 CCCAGCAGGCTCTGCATGGTGGG - Intronic
902596430 1:17512731-17512753 CATAATAAGATCTGCAGGCTGGG + Intergenic
913246867 1:116877826-116877848 CCTAAAAGGCTCTGCAGTATGGG + Intergenic
922731525 1:227950879-227950901 CCTAAGAAGCTCTCCAGGTAAGG + Intergenic
923563807 1:235061861-235061883 GCTTACAAGCTCTCCAGGTTGGG + Intergenic
1063709912 10:8467541-8467563 CATGACATGCTGTGCAGGGTGGG + Intergenic
1065421340 10:25547644-25547666 CCTAACTGGCTCTGCTGTGTGGG - Intronic
1066191539 10:33060610-33060632 ATTCACAAGCTCTGCAGGCTTGG - Intergenic
1067704737 10:48598410-48598432 ACTTACAAACTCTGCAGGGCGGG + Intronic
1068331532 10:55577503-55577525 ACTAATAAGTTCTGGAGGGTAGG - Intronic
1073462070 10:103671594-103671616 CCTAGCAAGCTCTCGAGGGGTGG + Intronic
1075131423 10:119743052-119743074 GTTAACAAGCTGTGCAGTGTTGG + Intronic
1077276772 11:1715172-1715194 GCCAACAAGGTCAGCAGGGTTGG - Intergenic
1078136971 11:8659616-8659638 TCTAACAAGCTCTCCAGATTGGG - Intronic
1080889855 11:36400096-36400118 CCCAACTCGCCCTGCAGGGTTGG - Intronic
1081692634 11:45088564-45088586 CCTTGCAGGCTCTGCAGGCTGGG - Intergenic
1083698594 11:64458859-64458881 CCTAAAATCCTCTGCAGCGTTGG + Intergenic
1084112806 11:67024421-67024443 CCTAAGCAGCTCTGCAGAGTGGG + Intronic
1084358299 11:68653584-68653606 CCTACCCAGCTCTGCAGGCCAGG + Intergenic
1085508658 11:77074327-77074349 CAGAACCAGCTCTGCAGGGCTGG - Intronic
1088644662 11:111908089-111908111 CCTAACAAGCTCTGAGGTATAGG - Intergenic
1089609453 11:119661332-119661354 CCTCACAAGCTGGGCAGTGTTGG + Exonic
1090370077 11:126244358-126244380 ACTAACAAGCTTAGCAAGGTTGG + Intronic
1091450756 12:570702-570724 CCGGACCAGCTCTGCAGGGAGGG - Intronic
1091897795 12:4119075-4119097 CTTGACAAGCCCAGCAGGGTTGG - Intergenic
1092062617 12:5563749-5563771 CCTGACAACCACTCCAGGGTAGG - Intronic
1095393687 12:41739600-41739622 CATGGCAAGCTCTGCAGGGTTGG + Intergenic
1102548855 12:113676262-113676284 ACTGACAAGCTTTGCAAGGTGGG + Intergenic
1103749183 12:123147850-123147872 CCTGACACACTGTGCAGGGTAGG - Intronic
1108291149 13:48962595-48962617 CCTAACAAACTCTTCAGAATTGG + Intergenic
1109552581 13:63922896-63922918 CTTAAAAAGCTCTTCAGTGTAGG + Intergenic
1110534429 13:76634816-76634838 CCTAAAAATATCTGCAAGGTAGG - Intergenic
1111574610 13:90135778-90135800 CCTCAGAAGCTAAGCAGGGTTGG - Intergenic
1113045972 13:106155426-106155448 TCTCACAAGCTAAGCAGGGTCGG - Intergenic
1113331566 13:109332891-109332913 CCTTACAAACCCTGCAAGGTGGG - Intergenic
1115769524 14:36655695-36655717 GCAAAGAAGCTCTGCAGGGAAGG - Intergenic
1117523701 14:56576534-56576556 ACTAGCAGGCTCTGCATGGTTGG - Intronic
1118991915 14:70804751-70804773 TCTAAAAACCTCTGCAGGGAAGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121996271 14:98606066-98606088 CCTAACTGGCTCTGGAGGGTGGG - Intergenic
1123034892 14:105467949-105467971 CCTCACAAGCACTGCATGGCTGG - Intronic
1125793690 15:42388939-42388961 CCTACGAAGCTCTGAAAGGTGGG + Exonic
1128236420 15:66070600-66070622 CCTATCTAGCTCTGCAGATTTGG - Intronic
1128866272 15:71117030-71117052 CCTATAAATCTCTGCAGGGCTGG + Intronic
1129763557 15:78146729-78146751 CCTCACTAGATCTGGAGGGTAGG + Intronic
1131503901 15:92998665-92998687 CCTACCTAATTCTGCAGGGTAGG - Intronic
1132100185 15:99017450-99017472 CCTAAGAAGGTCTGCAGCATCGG - Intergenic
1139371533 16:66472180-66472202 CCTATCCAGCTCTGCCTGGTAGG - Intronic
1140340464 16:74154146-74154168 CAGAATCAGCTCTGCAGGGTGGG - Intergenic
1142557550 17:790134-790156 GCTAACAAGCTGTGCGGGGGAGG + Intronic
1147175574 17:38654275-38654297 CCTGACAGGCTCTGCAGGCTGGG - Intergenic
1149441504 17:56678312-56678334 CCTACCAAGCTCTCCAGCTTGGG - Intergenic
1149500775 17:57150718-57150740 CCCAATAAGATCTGCAGAGTGGG - Intergenic
1150166519 17:62948866-62948888 GCTAACAAGTTCAGCAAGGTTGG + Intergenic
1151354183 17:73548773-73548795 CCAACCAGGCTCTGCATGGTGGG + Intronic
1151713062 17:75817733-75817755 CCTAACCAGCTCTGCAGCCCAGG - Intronic
1152699188 17:81810813-81810835 GCACACCAGCTCTGCAGGGTAGG - Exonic
1158951588 18:62500035-62500057 CTTAAGAAGCTCTGCAAGGGAGG - Intergenic
1163552137 19:17971367-17971389 CCCAACAAGCTGGGCAGGGGTGG - Intronic
1166743131 19:45126182-45126204 CCTCACAGGCTCTGCAGGGAAGG - Intronic
1166866877 19:45844025-45844047 CCTATGAAACTCTGCATGGTAGG - Exonic
1167138671 19:47634173-47634195 CTTGACGGGCTCTGCAGGGTGGG + Intronic
925583349 2:5437051-5437073 CCTAACAACCCCTGCAAGGTTGG - Intergenic
932633969 2:73371730-73371752 CCTTGCAACCTCTGCAGGGCAGG + Intergenic
932837593 2:75051669-75051691 TCTAACAAGCTCTGAGGGGATGG - Intronic
935756956 2:106283792-106283814 CCTATCCAGATCTGAAGGGTGGG + Intergenic
936112608 2:109677244-109677266 CCTATCCAGGTCTGAAGGGTGGG - Intergenic
946507322 2:220315628-220315650 TCTAGCCAGCTGTGCAGGGTTGG - Intergenic
948777460 2:240297080-240297102 CCTGACATGCTCTGCAGAGATGG - Intergenic
1170895457 20:20409109-20409131 CCCAACAAGCCCTGCGGGGGTGG - Intronic
1172872807 20:38146525-38146547 CCTAACAACCACTGGAGGGATGG + Intronic
1179025534 21:37675898-37675920 GCTGACAAGCGCAGCAGGGTCGG - Intronic
1184271696 22:43388082-43388104 CCTCACCAGTTCTGCAAGGTAGG - Intergenic
952874729 3:37934949-37934971 CTGTACAAGCTCTGGAGGGTAGG - Intronic
953750588 3:45605708-45605730 CCTCAAAAGGCCTGCAGGGTTGG - Intronic
954713908 3:52517711-52517733 CCTAAGGGCCTCTGCAGGGTGGG + Intronic
957174866 3:76794290-76794312 CCTAGCAAGCTATTCAGGGTAGG + Intronic
965776344 3:172235708-172235730 CCAGACAATCTCTGCAGGGAAGG - Intronic
970230852 4:13909315-13909337 CATTAAAAGCTCTGCATGGTTGG + Intergenic
975165171 4:71170056-71170078 CCCAACATGCTCTGCATGGCTGG + Intergenic
983045331 4:162980156-162980178 CATAAAAATCTCTGAAGGGTGGG - Intergenic
983503632 4:168528544-168528566 TCTCGCAAGCTCTGTAGGGTAGG + Intronic
987128007 5:14833425-14833447 CCTAACAAGCTCTGCAGGGTAGG - Intronic
988573163 5:32392027-32392049 CCTAAAAAGCACTGCTGGCTGGG - Intronic
988996637 5:36721652-36721674 CCTCCCAAGCTCCCCAGGGTGGG - Intergenic
990442568 5:55861302-55861324 CCTAACATGGTCTGCAGCCTGGG - Intronic
991430112 5:66535582-66535604 CATCACAAGCTGTGCTGGGTTGG + Intergenic
991728211 5:69558494-69558516 CCCACTAAGCCCTGCAGGGTTGG + Intergenic
991731560 5:69594390-69594412 CCCAATAAACTCTCCAGGGTGGG - Intronic
991804640 5:70413641-70413663 CCCACTAAGCCCTGCAGGGTTGG + Intergenic
991807992 5:70449536-70449558 CCCAATAAACTCTCCAGGGTGGG - Intergenic
991863391 5:71033475-71033497 CCCAATAAACTCTCCAGGGTGGG + Intergenic
991866744 5:71069381-71069403 CCCACTAAGCCCTGCAGGGTTGG - Intergenic
997259880 5:132457600-132457622 TCTGACAACCTCGGCAGGGTGGG - Intronic
998137021 5:139679201-139679223 CCTCACAAGGCCTGCAGAGTAGG - Intronic
998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG + Intronic
1000545430 5:162594416-162594438 ACTAACAAGCACTGCAGTATTGG + Intergenic
1000927563 5:167212524-167212546 CTTAAAAAGCTCTACAGGGACGG - Intergenic
1003501791 6:6709201-6709223 ACTAAGAAGCTGTGCTGGGTGGG + Intergenic
1009455929 6:63856108-63856130 CCTATCAGGCTCTGCTTGGTTGG - Intronic
1011676471 6:89739194-89739216 CCTAACAAGCAGAGCAAGGTAGG - Intronic
1015418626 6:132980672-132980694 ACTAACAAGGGCAGCAGGGTTGG + Intergenic
1017758868 6:157552740-157552762 CCTGAGAGGCTCTGCAGGGAAGG - Intronic
1020220609 7:6233824-6233846 TCTTACAAGTTCTGGAGGGTGGG + Intronic
1029707520 7:102283585-102283607 CCTCATATACTCTGCAGGGTGGG - Intronic
1033203700 7:139397554-139397576 CCTCAAAATCTCTGGAGGGTTGG - Intronic
1034202716 7:149292636-149292658 CCAAACAAGCTCTGTCGGGAGGG - Intronic
1035278483 7:157762902-157762924 CCTAACATGCTTTTCAGGGGCGG - Intronic
1037730475 8:21519531-21519553 CCTTCCTAGCTCTCCAGGGTGGG + Intergenic
1039014286 8:33128927-33128949 CCTCATGAGCTCTACAGGGTAGG + Intergenic
1041771122 8:61473425-61473447 CCTATGCAGCTCTGCACGGTGGG - Intronic
1044280156 8:90345378-90345400 TCTTAAAAGCTCTGCAGGTTTGG + Intergenic
1046581898 8:116103289-116103311 CTTCACAAGGTCTGCAGGATCGG + Intergenic
1048757202 8:137753014-137753036 CATAACAAGTTTTGCAGGGTGGG + Intergenic
1053242121 9:36504589-36504611 CCCAACAGCCTCTGCAGGGAGGG - Intergenic
1057918467 9:99075833-99075855 GCTAGGAAGCTCTGCAGAGTTGG + Intergenic
1061610194 9:131740534-131740556 CTCAACAAGCTCTGCTGGCTGGG + Intergenic
1189438695 X:41015463-41015485 CCTCACAAGCTCTTTAGGGCTGG - Intergenic
1193375719 X:80758370-80758392 TCTAACAAGCTCTGCAGTGATGG + Intronic
1198619163 X:138487798-138487820 CCTCACAAGCTCTACAGCCTGGG - Intergenic
1198850662 X:140962617-140962639 GCTCACAAGTTCTGGAGGGTGGG + Intergenic