ID: 987129916

View in Genome Browser
Species Human (GRCh38)
Location 5:14850667-14850689
Sequence ACAGCAGCCAGCTCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987129916_987129921 4 Left 987129916 5:14850667-14850689 CCTCTCCTGGAGCTGGCTGCTGT 0: 1
1: 0
2: 3
3: 42
4: 429
Right 987129921 5:14850694-14850716 AGGAAAGGAACCCTTTACAAAGG 0: 1
1: 0
2: 0
3: 13
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987129916 Original CRISPR ACAGCAGCCAGCTCCAGGAG AGG (reversed) Intronic
900186668 1:1336224-1336246 ACGGCAGCCAGCTCCCGGACAGG + Exonic
901151679 1:7107600-7107622 GCAGGAGCCACCTCCCGGAGGGG + Intronic
902654502 1:17858327-17858349 AGAGAAGCCAGCTCAGGGAGGGG - Intergenic
902702637 1:18183037-18183059 AGGGCAGCCAGGCCCAGGAGGGG - Intronic
903497285 1:23778251-23778273 GCAGCATCCAGCGCCAGGACTGG + Intergenic
904002891 1:27348922-27348944 CTGGCAGCCAGCTGCAGGAGCGG - Intronic
904198995 1:28807142-28807164 CCATCAGCAAGCTCCAGGAGGGG - Intergenic
904471877 1:30741177-30741199 ACAGGAGCCAGCACCCTGAGGGG - Intronic
904904739 1:33886696-33886718 CCAGCAGCCAGCCGCAGGAAAGG + Intronic
905183259 1:36179139-36179161 ATAGCAGCCCTCTCCAGGACAGG - Intronic
905232533 1:36523214-36523236 CAAGCAGCAAGCCCCAGGAGGGG + Intergenic
905280449 1:36845860-36845882 TCAGCACCCAGCAGCAGGAGAGG - Intronic
905402448 1:37713575-37713597 ACTGAAGTCAGCCCCAGGAGAGG - Intergenic
905511746 1:38527271-38527293 ACAGCAGTGAGGTACAGGAGAGG - Intergenic
905923623 1:41734731-41734753 ACAGCAGCCAGCCCCGGGGCAGG + Intronic
906138750 1:43520552-43520574 ACAGCAGCTGCCTCCAGGGGAGG - Intergenic
906371581 1:45258478-45258500 GCAGAAGCCTGCTGCAGGAGTGG + Intronic
907892707 1:58650712-58650734 AGGGCAGCCTACTCCAGGAGAGG - Intergenic
910633958 1:89386494-89386516 ACATCAGCCAGCCCAATGAGGGG + Intergenic
912070290 1:105800951-105800973 GCAGAAGTCAGCTGCAGGAGTGG - Intergenic
912270068 1:108199998-108200020 ACATCGGCGAGCTGCAGGAGGGG - Exonic
912277351 1:108273257-108273279 ACATCATTGAGCTCCAGGAGGGG + Intergenic
912290877 1:108421099-108421121 ACATCATTGAGCTCCAGGAGGGG - Intronic
912435238 1:109656881-109656903 ACAGCCTGCAGCTCCAGCAGGGG - Intronic
912439639 1:109688339-109688361 ACAGCCTGCAGCTCCAGCAGGGG - Intronic
912442956 1:109712787-109712809 ACAGCCTGCAGCTCCAGCAGGGG - Intronic
912468536 1:109890745-109890767 AGAGGAGCAGGCTCCAGGAGTGG - Intergenic
914386284 1:147172681-147172703 GCAGCCTCCAGCGCCAGGAGGGG + Intergenic
914400575 1:147316485-147316507 ACAGCAGGCAGCTGCAGCTGTGG - Intergenic
914412811 1:147447679-147447701 GCTGCAGGCAGCTCCTGGAGTGG + Intergenic
915512137 1:156392181-156392203 GCAGCAGACAGCTCCTGGAAAGG - Intergenic
915591853 1:156875338-156875360 ACAGGAGCCAGCACAGGGAGAGG + Intronic
915630885 1:157153634-157153656 ACATCAGCCAGCCCCTGGAAGGG + Intergenic
917320887 1:173780488-173780510 ACAGTAGCCAGGGCCAGGTGCGG + Intronic
918697364 1:187560654-187560676 ACAGCAGCCAGCTGCAGCTATGG + Intergenic
918955199 1:191198866-191198888 ACAGCAGCCAGCTGCAGCTGTGG - Intergenic
919012530 1:191983521-191983543 GCAGCAGCTAGCTACAGTAGTGG + Intergenic
919478455 1:198056769-198056791 GCAGCAGCCAGCCACAGCAGTGG + Intergenic
919910277 1:202106798-202106820 AGCTCAGCCAGTTCCAGGAGGGG + Intergenic
920212083 1:204335598-204335620 GCAGCCCCCAGCTCCAGGACTGG + Intronic
920337732 1:205256564-205256586 ACAGCAGCCAGCCTCACCAGGGG - Intronic
920960213 1:210656881-210656903 CCAGCAGCCAGCCCCTGGAGGGG - Intronic
921314986 1:213881960-213881982 ACAGAAGCCATCTCCAGGCCAGG + Intergenic
922785774 1:228281639-228281661 GGGGCAGCCAGCTCCAGCAGAGG + Intronic
923786080 1:237070764-237070786 ACAGGTGCCAGCTCCATGTGAGG + Intronic
924320022 1:242839301-242839323 ACAGGAGCAAGCTCCATGCGTGG - Intergenic
924481520 1:244439578-244439600 ACAGCATGCAGCTCCAGGAGAGG - Intronic
924930918 1:248731798-248731820 ACAACAGACAGGCCCAGGAGAGG + Intronic
1065129332 10:22604757-22604779 ACATTGGCAAGCTCCAGGAGAGG + Intronic
1065218385 10:23472382-23472404 GCAGCAGCCAGCTCAGGGAAAGG + Intergenic
1065236609 10:23658795-23658817 TCTGAAGCAAGCTCCAGGAGAGG - Intergenic
1065293729 10:24255586-24255608 ACAGGAGCAAGGTACAGGAGTGG + Intronic
1065895427 10:30159164-30159186 ACAGCAGCCTGGACGAGGAGGGG - Intergenic
1066392118 10:34986009-34986031 TCAGCACCCAGCTCCAGCAATGG + Intergenic
1067249515 10:44575216-44575238 ACAGCTGCCAGCACCAGGCTCGG - Intergenic
1067993354 10:51241010-51241032 TAAGCACCCAGCTCAAGGAGTGG - Intronic
1068717119 10:60200620-60200642 ACAGCAGCGAGCTGCAGATGTGG - Intronic
1069535006 10:69246733-69246755 TCACCAGCCAGCTCCATGCGAGG - Intronic
1070457628 10:76632866-76632888 GCATCACCCAGGTCCAGGAGAGG - Intergenic
1070711370 10:78685476-78685498 CCAGCAGCCACTTCCAGGATGGG + Intergenic
1071264680 10:83954472-83954494 AGACAAGGCAGCTCCAGGAGGGG - Intergenic
1071293464 10:84203196-84203218 AGACCAGCCATCTCCAGCAGGGG - Intronic
1072294141 10:93993720-93993742 CCAGCAGCCAGCTCCGGGGGAGG + Intergenic
1072554868 10:96507072-96507094 AGAGCAGCCCCCTCCAAGAGGGG + Intronic
1072608569 10:97002306-97002328 ACAGCTGCCAGTGCCAGGATGGG - Exonic
1074770645 10:116731317-116731339 CCAGCTGCCAGGTCTAGGAGGGG + Intronic
1075487552 10:122837962-122837984 TCAGCTGTCAGCTCCAGCAGAGG + Intronic
1076668446 10:132105734-132105756 AGAGAAGGCAGCTCCAGGAAGGG + Intronic
1076799056 10:132812281-132812303 ACCCCAGCCAGCTCCAGCACAGG - Intronic
1076842082 10:133050634-133050656 CCAGCAGCCGGCTCCAGGCTGGG - Intergenic
1077058906 11:609186-609208 TCAGCTGCCACCTCCAGGACAGG - Exonic
1078624443 11:12941075-12941097 ACAGCAGCCTCCCCCAGGAGAGG - Intronic
1078874424 11:15379013-15379035 ACAGGTGCCAGCTACATGAGAGG - Intergenic
1081489386 11:43555687-43555709 ACCGCAGTCAGCTCAAGCAGGGG + Intergenic
1082998235 11:59269343-59269365 CCAGCAGCCAGGTCCAGCTGTGG - Intergenic
1083144274 11:60747026-60747048 CCAGCAGGCTGGTCCAGGAGTGG + Intergenic
1083617108 11:64031776-64031798 ACATCAGAAAGCTCCAGCAGTGG - Intronic
1083941347 11:65897751-65897773 ACAGCTCCCAGCTCAAGGGGAGG + Intronic
1084456185 11:69269395-69269417 GCAGGGCCCAGCTCCAGGAGTGG - Intergenic
1084661318 11:70548181-70548203 GCAGCCGCCTGCTCCAGGGGTGG - Intronic
1085344977 11:75762854-75762876 ACAGCACCCAGCACAAGGATGGG + Intronic
1085531386 11:77194251-77194273 ACAGGAGGCAGGGCCAGGAGAGG + Intronic
1085644561 11:78214590-78214612 ACAGCAGCCACCTGCAGGTTGGG + Exonic
1085732499 11:79011592-79011614 CCAGCAGCCAGTTCCTGGAGAGG - Intronic
1085978622 11:81693911-81693933 ATAGCAGCCAGCCACAGCAGTGG - Intergenic
1089090468 11:115870191-115870213 GCAGCAGCCAGCTGCAGCAGTGG + Intergenic
1089255539 11:117192170-117192192 TGAGCAGCCAGCCCCAGGAAGGG + Intronic
1089310801 11:117556987-117557009 CCTGCATCCATCTCCAGGAGAGG - Intronic
1089626283 11:119753097-119753119 ACGGCTGCCACTTCCAGGAGGGG - Intergenic
1090414377 11:126530596-126530618 ACAGCTGCGAGCTCCTGGAGGGG - Intronic
1091224365 11:133948829-133948851 ACAGCAGGCACCTCCAACAGTGG + Intronic
1092064158 12:5575881-5575903 ACGTCAGCCAGCTGAAGGAGGGG - Exonic
1092407321 12:8230118-8230140 TCAGGAGCCAGCTCCTGGATGGG + Intergenic
1096109730 12:49021532-49021554 TCTGCCCCCAGCTCCAGGAGGGG - Exonic
1096587841 12:52634684-52634706 CCCACTGCCAGCTCCAGGAGAGG - Intergenic
1097513103 12:60568047-60568069 GCAGGAGCCTGCTCCAGGGGAGG + Intergenic
1098439717 12:70504738-70504760 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
1098689176 12:73465364-73465386 ACAGCAGGCAGCCACAGCAGTGG + Intergenic
1098715193 12:73821369-73821391 ACAGAAGTCAGCTGTAGGAGTGG - Intergenic
1099286539 12:80718950-80718972 AGAGAAGCCAGATCCTGGAGAGG - Exonic
1099684360 12:85866192-85866214 ACAGCAGTCAGCTGCAGCTGTGG + Intergenic
1101435494 12:104660610-104660632 TGAGCAGCCAAGTCCAGGAGAGG - Intronic
1101754006 12:107607043-107607065 ACAGCATCTATCTCCAGGGGAGG - Intronic
1101755734 12:107619315-107619337 ACAGCAGTCAGCTGCTGAAGAGG + Intronic
1101773814 12:107775706-107775728 CCAGCAGCGAGCCCGAGGAGGGG + Exonic
1101854916 12:108434208-108434230 ATAGCATCCAGATCCAGGAAGGG - Intergenic
1102947788 12:117005172-117005194 CCAGCAGCAAGATCCAGGAGTGG + Intronic
1103748347 12:123141552-123141574 AGAGCAGCCGTCTCCTGGAGAGG + Intronic
1103940194 12:124497184-124497206 ACAGCAGCCAGTTGAAGGGGTGG - Intronic
1104365250 12:128170829-128170851 ACAGCAGCCTGCTGCAGGCTGGG + Intergenic
1107462828 13:40620627-40620649 ACAGCAGCCAGCACAGGGAACGG + Intronic
1108518927 13:51227338-51227360 AGATCAGACAGCTCCTGGAGAGG - Intronic
1108602080 13:52003756-52003778 ACAGCTGCCTGCTCCAGGTGGGG - Intronic
1109326975 13:60879543-60879565 ACAGCAACCATCTCCATTAGTGG + Intergenic
1109718370 13:66246188-66246210 ACAGAAGTCTGCTGCAGGAGTGG + Intergenic
1110704534 13:78589397-78589419 ACCGCGGCCAGCTCCAGGGAGGG - Intergenic
1111045183 13:82805426-82805448 ACAGCAGGCAGCTGCAGCAGTGG - Intergenic
1111255347 13:85660694-85660716 ACAACAGCCAGAACCAGAAGAGG + Intergenic
1111305655 13:86409731-86409753 ACAGCAGGTAGCTGCAGCAGTGG - Intergenic
1111309920 13:86471570-86471592 ACAGGAGCAAGCTCCATGCGGGG + Intergenic
1111564142 13:89992391-89992413 ACTCCAGCCAGCTTCAGCAGTGG - Intergenic
1111908321 13:94281817-94281839 ACACCAGCTAGCTTCAGGTGAGG - Intronic
1112388812 13:98964182-98964204 ACAGCAGCAGGGACCAGGAGTGG + Intronic
1112864139 13:103872561-103872583 ACAAAAGCCTGCTGCAGGAGCGG - Intergenic
1113527715 13:110993917-110993939 ACAGCAGGCAGCCACAGCAGTGG - Intergenic
1113682569 13:112254573-112254595 ACAGCAGCTCGCACCAAGAGTGG + Intergenic
1115065681 14:29257006-29257028 GCAGAAGCCTGCTGCAGGAGTGG - Intergenic
1116811153 14:49541244-49541266 ACAGAAGCCTGCTCCAAGGGTGG + Intergenic
1118386057 14:65256412-65256434 ACAGCAGGCATCTGCAGGAAGGG - Intergenic
1119461110 14:74804565-74804587 ACATTAGCCAGTTGCAGGAGGGG - Intronic
1121240967 14:92429891-92429913 CATGCAGCCAGCCCCAGGAGAGG - Intronic
1121377886 14:93430752-93430774 AACGCGGGCAGCTCCAGGAGGGG + Intronic
1121825656 14:97007877-97007899 ATAGCAAGGAGCTCCAGGAGAGG + Intergenic
1122812092 14:104294070-104294092 ACAGCCGCCAGCCTCAGGACAGG - Intergenic
1123024495 14:105418405-105418427 CCAGCGGCCAGGTGCAGGAGAGG - Intronic
1123124968 14:105940025-105940047 GCAGCAGTCAGGTCCAGGACTGG - Intergenic
1124222220 15:27860912-27860934 GCAGCAGCCAGGCCTAGGAGAGG + Intronic
1125132400 15:36298964-36298986 ACAACAGCCTGCTACAGGTGAGG - Intergenic
1126088294 15:45029467-45029489 ACAGGAGCAAGCTCCTTGAGGGG + Intronic
1127042350 15:54990950-54990972 ACAGCAGGCAGCTGCAGCAGTGG - Intergenic
1127570541 15:60237034-60237056 AAAGCAGCCAACTACAGGAAGGG + Intergenic
1128879207 15:71227666-71227688 CCAGCATCCTGCTCCAGGAAGGG + Intronic
1130709908 15:86269954-86269976 ATAGCACCCAGCACCAGCAGTGG + Exonic
1131942790 15:97585446-97585468 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
1132533387 16:465128-465150 ACAGCTACCAGCTTCATGAGCGG - Intronic
1132632792 16:927986-928008 ACAGCAGCAAAACCCAGGAGGGG + Intronic
1133021220 16:2967801-2967823 CCAGCAGACAGCTCCTAGAGAGG - Exonic
1133284778 16:4685535-4685557 GCAGCAGCCAACTCCAAGAGCGG - Intronic
1134046933 16:11107986-11108008 ACAGAATGCAGCTGCAGGAGGGG - Intronic
1136027902 16:27481759-27481781 ACAGCAGCCAGATGCAGCAGGGG - Intronic
1136055843 16:27688972-27688994 ACTACAGCCAGGGCCAGGAGTGG + Intronic
1137274964 16:46927376-46927398 ACAGCTGCCAGTGCCTGGAGTGG + Intronic
1137620799 16:49875677-49875699 ACAGTGGTCAGCTCAAGGAGAGG + Intergenic
1138592600 16:58010230-58010252 AGAGCAGGCAGCCCCAGGAGAGG - Intronic
1139474577 16:67196594-67196616 GCTGCAGCCCTCTCCAGGAGTGG - Intronic
1139489225 16:67277909-67277931 ACAGCAGGCAGATTCAGGGGAGG - Exonic
1139580264 16:67869018-67869040 CCAGCAGCCAGCCTGAGGAGTGG - Intronic
1139630377 16:68228215-68228237 AAAACACCCAGCTCCAAGAGGGG - Exonic
1140520524 16:75577036-75577058 AAAGCAGCCAGCTCCTTCAGGGG - Intronic
1140954173 16:79847082-79847104 ACAGGAGCCCGCACCAGCAGTGG - Intergenic
1141147722 16:81543373-81543395 TAAGCAGCCAGCTACAGGGGTGG - Intronic
1141370548 16:83482404-83482426 ACAGCATCAATCTCCAAGAGAGG - Intronic
1141602984 16:85137462-85137484 GCAGCAGGGAACTCCAGGAGGGG - Intergenic
1141688231 16:85582340-85582362 ACCGCAGCCAGCTTCTGCAGTGG - Intergenic
1142011288 16:87715618-87715640 ACAGCAGACAGTCCCAGTAGAGG - Intronic
1142143519 16:88483095-88483117 ACAGGAGCCAGCCCCAGGCGAGG - Intronic
1143037886 17:4010230-4010252 ACAGCACCCAGCTACTCGAGAGG + Intronic
1143176380 17:4957592-4957614 TAAGAAACCAGCTCCAGGAGAGG + Intergenic
1143321009 17:6069191-6069213 TTAGCAGCCAGCTCCGGGTGAGG + Exonic
1143871118 17:9957869-9957891 ACCCAAGCCAGCTCCAGAAGGGG + Intronic
1146729262 17:35180395-35180417 ACTGCCCCCAGCTCTAGGAGGGG - Intronic
1148170137 17:45512420-45512442 ACAGAGGCAAGCTCCAGGAATGG + Intergenic
1148170613 17:45516413-45516435 ACAGAGGCAAGCTCCAGGAATGG + Intergenic
1148279069 17:46333400-46333422 ACAGAGGCAAGCTCCAGGAATGG - Intronic
1148301286 17:46551253-46551275 ACAGAGGCAAGCTCCAGGAATGG - Intronic
1148365412 17:47052143-47052165 ACAGAGGCAAGCTCCAGGAATGG - Intergenic
1148452109 17:47785727-47785749 AAGACAGTCAGCTCCAGGAGAGG + Intergenic
1148622233 17:49043446-49043468 ACAGCAGCCAGGTTCAGGCCAGG - Exonic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1148883683 17:50755244-50755266 ACAGCAGCAAGCTCCTGCAGAGG - Exonic
1150196551 17:63305068-63305090 ACAGCAGGCAGCTGCAGCCGTGG + Intronic
1150781329 17:68125022-68125044 ACAGAGGCAAGCTCCAGGAATGG + Intergenic
1150978837 17:70119440-70119462 ACAGAAGCCTGCTGCAGGGGTGG - Intronic
1151110312 17:71668519-71668541 ACCACAGCCAGCTCCTGGAATGG + Intergenic
1151155492 17:72121186-72121208 ACAGCTGCCCGCTCCAAGTGGGG - Exonic
1151429976 17:74055819-74055841 ACAGCAGCCAACTCAAGACGAGG - Intergenic
1151730182 17:75906379-75906401 CCACCACCCAGCCCCAGGAGAGG + Intronic
1152037040 17:77880038-77880060 CCAGCAGCGAGGTTCAGGAGGGG - Intergenic
1153156222 18:2152495-2152517 ACATCATCCAGCTCCTGGAGGGG - Intergenic
1155204291 18:23544381-23544403 CCAACAGCCAGCACCAGGAACGG + Exonic
1155441356 18:25865746-25865768 ACTGCACCCAGCTCCCAGAGGGG - Intergenic
1156452284 18:37273771-37273793 TCTGCAGGCAGCTCCGGGAGAGG + Intronic
1156476973 18:37411681-37411703 AGAGCAGCCAGCACCAGGCAGGG + Intronic
1156516421 18:37684333-37684355 ACAGCACCCAGCTCCAGGCATGG - Intergenic
1156539390 18:37894554-37894576 ACCGCAGCCAGCTGGAGGGGTGG - Intergenic
1156779899 18:40838521-40838543 AGAGCACTGAGCTCCAGGAGAGG + Intergenic
1157298023 18:46459791-46459813 ACATCCACCACCTCCAGGAGGGG + Exonic
1157719367 18:49912032-49912054 ACACAGCCCAGCTCCAGGAGAGG - Intronic
1158519776 18:58162266-58162288 ACAGAGGCCAGCTTCAGGAGAGG - Intronic
1158845107 18:61433738-61433760 ATAACAGCAAGCACCAGGAGAGG - Intronic
1160727045 19:621970-621992 ACAGAAGCCACCTCCAGAAACGG + Intronic
1162752854 19:12839097-12839119 TCAGCATCCAGCTCCCGAAGAGG - Intronic
1163888294 19:19988901-19988923 ACAGCAGCCAGCCACAGCTGTGG - Intergenic
1164235060 19:23324402-23324424 ACAGCACCCAGCACAAGTAGTGG + Intronic
1165248771 19:34513585-34513607 ACATCATCTACCTCCAGGAGAGG + Intergenic
1165266249 19:34665398-34665420 ACATCATCTACCTCCAGGAGAGG - Intronic
1165273885 19:34732461-34732483 ACATCATCTACCTCCAGGAGAGG - Intergenic
1165450616 19:35879967-35879989 ACCGCGGACAGCTCCAGGACAGG - Intergenic
1165453100 19:35896513-35896535 GCAGCAGCCGCCACCAGGAGAGG + Exonic
1165831136 19:38730998-38731020 ACTGCAGCCAGCACCTGGATGGG - Exonic
1166269337 19:41704335-41704357 GCAGGAGGCAGCACCAGGAGTGG + Intronic
1166978565 19:46619726-46619748 ACAGCAGCCAACTCTTCGAGGGG - Intergenic
1167419387 19:49394316-49394338 ACAGCAGGAAGCTTCAGGAGGGG - Intronic
1168600973 19:57718421-57718443 ACTGCACCCAGCCCCAGCAGTGG + Intronic
924973519 2:153264-153286 GCAGCAGTCAGCTACAGGTGTGG + Intergenic
925198733 2:1949215-1949237 GCAGCAGCCAGCGACAGGAGTGG + Intronic
926093421 2:10065072-10065094 CAAGCAGCGAGCTCCAGGGGAGG - Intronic
926467238 2:13206088-13206110 ACAGAAGCCTGCTGCAGGGGTGG + Intergenic
926577243 2:14595729-14595751 ACAGGAACCAGACCCAGGAGGGG + Intergenic
927014427 2:18943198-18943220 ACTGCTGCCACCTCCAGAAGTGG + Intergenic
927092709 2:19724274-19724296 ACTGCAGCCAGATCCAGAGGCGG + Intergenic
927508981 2:23632553-23632575 CCAGCTACGAGCTCCAGGAGGGG - Intronic
928591478 2:32820226-32820248 TCAGCAGGCAGTTCCTGGAGAGG + Intronic
929598480 2:43190701-43190723 CCAGCAGCCAGCTTAGGGAGAGG - Intergenic
929754159 2:44749965-44749987 GCATCAGCCATCTCCATGAGGGG - Intronic
929876626 2:45801783-45801805 ACAGCAGCCTGCTTCAGGTTTGG - Intronic
930711034 2:54551348-54551370 ACAGCAGCCAGAGCCAGGGCTGG - Intronic
931883115 2:66587593-66587615 AAAGGAGACAGTTCCAGGAGTGG + Intergenic
932087432 2:68774725-68774747 ACAGCGGCCGGCTAGAGGAGGGG - Intronic
932278702 2:70471401-70471423 GGATGAGCCAGCTCCAGGAGGGG + Intronic
932336293 2:70933091-70933113 CCGGCAGGCAGATCCAGGAGCGG - Exonic
933818358 2:86087306-86087328 ACATCATGCATCTCCAGGAGGGG + Intronic
935134876 2:100291361-100291383 CCAGCAACCAGCACCAGCAGAGG - Intronic
936520632 2:113210121-113210143 CCAGCAGCCAGCCCCAGGGAGGG - Intergenic
937527247 2:122786651-122786673 ACATCTGCCATCTCCATGAGGGG + Intergenic
938206954 2:129432060-129432082 ACAGCAGCCAGCTCCGTGCCTGG - Intergenic
938749155 2:134312378-134312400 ACAGCAGGAAGCTGCAGTAGTGG - Intronic
939450175 2:142363773-142363795 ACACAAGTCAGCTCCAGCAGTGG + Intergenic
939808913 2:146807984-146808006 ACAGCAGACAGCTGCAGCTGTGG - Intergenic
940425943 2:153532159-153532181 GCAGAAGCCTGCTGCAGGAGTGG - Intergenic
941063900 2:160879194-160879216 ACAGAAGCCAGGTCCTTGAGTGG - Intergenic
941629344 2:167866688-167866710 ACAGGAGCCTCTTCCAGGAGAGG + Intergenic
942250446 2:174043294-174043316 AAAGCAGCCAGCAACAAGAGTGG - Intergenic
943076342 2:183200096-183200118 ACAGCAGCTAGCTACAGGAGCGG - Intergenic
943271572 2:185811944-185811966 GCAGAAGCCTGCTGCAGGAGTGG + Intronic
944199841 2:197094905-197094927 ACAACAGCCAGATCGAGAAGGGG - Intronic
944539511 2:200742598-200742620 AGAGCAGGCAGCTCCGGGTGTGG + Intergenic
944855150 2:203760142-203760164 ACAGCTCGCAGCTCCAGGAGAGG - Intergenic
945780644 2:214167324-214167346 CCAGCAGACAGCACCAGCAGTGG + Intronic
946179825 2:217942608-217942630 ACCCCAGGCAGCTTCAGGAGGGG + Intronic
946339654 2:219059309-219059331 CCAGCAGCCAGGTCCGCGAGGGG - Intronic
946456526 2:219831018-219831040 AAAGAAGGCAGCTCCAAGAGGGG - Intergenic
948704211 2:239779134-239779156 ACAGCGGACAGATGCAGGAGGGG + Intronic
948726931 2:239939857-239939879 ACTGCAGCCGGTTCCAGGAGGGG - Intronic
948800575 2:240431611-240431633 ACAGGTGCCAGCTCTTGGAGGGG + Intergenic
1168905925 20:1403770-1403792 GCAACACTCAGCTCCAGGAGTGG + Intergenic
1169980566 20:11379720-11379742 GCAGCAGCCAGCACTAGGACTGG + Intergenic
1170423798 20:16218379-16218401 ACAGCAACCAGATCTTGGAGAGG + Intergenic
1170496561 20:16930791-16930813 ACAGCAGGCAGCTGCAGCTGTGG - Intergenic
1172764012 20:37341518-37341540 CCAGCGGCCAGCACCGGGAGGGG - Intergenic
1173318920 20:41970055-41970077 ACCCCAGCCAGCTCCAGGCATGG + Intergenic
1173838506 20:46140884-46140906 AAAGCAGCCTGATCCTGGAGGGG + Intergenic
1174187542 20:48717297-48717319 ACCTCAGCCAACTCCAGGAAGGG + Intronic
1174268180 20:49347167-49347189 GCAGCTTCCAGCTCCCGGAGGGG - Intergenic
1175144052 20:56882542-56882564 AAAGCAGTCAGCACCAGGAATGG + Intergenic
1175882425 20:62268396-62268418 AAAGCAGAGAGCACCAGGAGGGG - Intronic
1175901506 20:62361638-62361660 AGAGCAGCCAGTGCCTGGAGTGG - Intronic
1175923440 20:62460778-62460800 GCCGCAGCCAGGTCCAGGAATGG + Intergenic
1177384960 21:20396935-20396957 ACAGGAGCATGCTCCATGAGGGG + Intergenic
1177511417 21:22092028-22092050 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
1180289518 22:10784131-10784153 ACAGCAGCCACCTTCCTGAGAGG + Intergenic
1180305381 22:11068668-11068690 ACAGCAGCCACCTTCCTGAGAGG - Intergenic
1181277292 22:21694989-21695011 AGAGCAGCCAGCCCCAGGCAGGG + Exonic
1181592698 22:23894882-23894904 ACAGCAGCTTGCTGTAGGAGCGG - Exonic
1182367423 22:29788538-29788560 ACAGCTGCCAGCTGGAGGACAGG - Intergenic
1182486514 22:30642335-30642357 ACTGCAGGAGGCTCCAGGAGAGG + Intronic
1182499106 22:30732687-30732709 ACAGCAGACAGGTCCAGGAGTGG - Intronic
1183085593 22:35485057-35485079 CCAGCAGCCAGTTCCAGGATGGG - Intergenic
1183089400 22:35511135-35511157 ACACAAGCCAGCTCCAGGCCTGG - Intergenic
1183094098 22:35541885-35541907 GCTGCAGCCAGCTCCAGAAGAGG - Intronic
1183275693 22:36896153-36896175 GCAGAAGCCTGCTGCAGGAGGGG + Intergenic
1183884520 22:40867047-40867069 ACAGCAGCCTACTCCACCAGTGG + Intronic
1184008990 22:41732551-41732573 TCAGCAGCCACCTCCAGCACAGG - Exonic
1185235916 22:49712830-49712852 GCAGCTGCCAGCTCCAGGCTGGG + Intergenic
950163338 3:10775979-10776001 GCCGCAGCCAACCCCAGGAGCGG - Intergenic
951180670 3:19654844-19654866 ACAGAAGTCAGCTGCAGGGGTGG - Intergenic
951734851 3:25852110-25852132 ACAGCAGGCAGCTCCACCTGTGG + Intergenic
952137254 3:30437190-30437212 CCAGCAGCAAGCACCAGCAGGGG - Intergenic
952872919 3:37918079-37918101 ACAGAAGGCTGCCCCAGGAGGGG + Intronic
953210665 3:40872344-40872366 ACAGCAGCCAGCACCAGTGAAGG - Intergenic
953792556 3:45959318-45959340 AGAGCAGACAGCTCCAAAAGAGG - Intronic
953917677 3:46930940-46930962 GCACCAGGCAGCTCCAGGAGGGG + Intronic
955111970 3:55958774-55958796 ACAGGAGCAGGCACCAGGAGTGG + Intronic
955500291 3:59576516-59576538 ACAGCAGTTAACTCCAGGGGTGG + Intergenic
955851110 3:63220836-63220858 ACAGCAACCAGCTCTAGGCCTGG - Intergenic
955960858 3:64340083-64340105 ACAGCAGGCAGGTACAGAAGTGG - Intronic
957268902 3:78003425-78003447 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
957307871 3:78481157-78481179 ACAGGTGCCAACTCCATGAGTGG - Intergenic
957609492 3:82449103-82449125 ACAGAAGTCAGCTTCAGGAGTGG + Intergenic
958837202 3:99159214-99159236 GCAGAAGCCTGCTGCAGGAGTGG - Intergenic
959694471 3:109234520-109234542 ACTGCAGGCAGCTGCAGCAGTGG - Intergenic
960233402 3:115254778-115254800 ACAGCAGTCAGCTGCAGCTGTGG - Intergenic
960724722 3:120658719-120658741 GCAGAAGCCAGCTGCAGGGGCGG - Intronic
961185515 3:124911873-124911895 ACAGAACTCAGCACCAGGAGTGG - Intronic
962087395 3:132206048-132206070 ACAGCAGCTGGGTCCAGGACTGG + Intronic
963038399 3:141051479-141051501 AAAGCACCCAGCCCCAGGGGAGG + Exonic
963461289 3:145617477-145617499 ACAGCAGGCAGCTGCAGCTGCGG + Intergenic
964375114 3:156041667-156041689 ACAGCAGGCAGCTCCACCTGCGG + Intronic
964651715 3:159018656-159018678 CCAGCAGCCAGGTAGAGGAGTGG + Intronic
966539674 3:181075349-181075371 ACAGCAGGCAGCTACAGCTGTGG + Intergenic
968085138 3:195870790-195870812 ACTGCAGACACCTCCAGGAGAGG - Intronic
968641390 4:1716736-1716758 CCAGGGGCCAGCTCCAGGACAGG + Exonic
969686962 4:8681050-8681072 AGAGCAGGAAGCCCCAGGAGAGG + Intergenic
970666552 4:18343194-18343216 ACAGCAGGCAGCTGCAGTGGAGG + Intergenic
971479572 4:27102261-27102283 GCAGCTCCCAGGTCCAGGAGTGG - Intergenic
971634183 4:29034901-29034923 CCAGTAGCCAGCTGCAAGAGTGG - Intergenic
972590200 4:40478532-40478554 ACAGGACTCAGGTCCAGGAGAGG + Intronic
973125306 4:46576061-46576083 GCAGAAGCCAGCTCTAGAAGGGG + Intergenic
976405815 4:84659563-84659585 CTAGCAGACAGATCCAGGAGGGG - Intergenic
976769331 4:88634354-88634376 ACAGCAGGCAGCCACAGCAGTGG - Intronic
976874542 4:89837245-89837267 AAAGCAGCGAGCGCCGGGAGAGG - Intronic
977671250 4:99698163-99698185 TCAGGAGCCATCTCAAGGAGAGG + Intergenic
978536584 4:109769654-109769676 TGAGCAGCCAGCTGGAGGAGAGG - Intronic
978822168 4:112979283-112979305 ACAGGTGCCAGCTCCATGCGAGG + Intronic
982017883 4:151174148-151174170 AGAGGGGCCAGCTCCAGGGGAGG - Intronic
983253698 4:165375205-165375227 ACAGAAGCCAGCCCCTTGAGGGG + Intronic
983884445 4:172964616-172964638 ACAGCAGCCTGCAGCAGAAGAGG - Intronic
984457963 4:179995224-179995246 ATTGCAGCCAGCTCCAGGAAGGG + Intergenic
985393370 4:189514924-189514946 AGAGCACCCTGCTGCAGGAGGGG - Intergenic
985731457 5:1551569-1551591 ACCCCAGCCAGCTCCAGGCCGGG - Intergenic
985733634 5:1565169-1565191 CCAGCTACCGGCTCCAGGAGGGG - Intergenic
985945072 5:3175581-3175603 ACAGCGGGCAGCACCAGGACAGG + Intergenic
987129916 5:14850667-14850689 ACAGCAGCCAGCTCCAGGAGAGG - Intronic
987988619 5:25181429-25181451 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
988782229 5:34532824-34532846 ACAACAGACACCTCCATGAGTGG - Intergenic
989401174 5:41009198-41009220 ACAGCACCAAGCTCCAGGTGGGG + Intronic
989676719 5:43981709-43981731 ACAGCAGGCAGCCGCAGCAGTGG + Intergenic
990314549 5:54571714-54571736 ACAGAACCCAGCTCAGGGAGTGG - Intergenic
994446217 5:99878739-99878761 ACAGCTGCCCCCCCCAGGAGTGG + Intergenic
994756010 5:103794074-103794096 TCAGCTGCCAGCTGCAGGACAGG + Intergenic
994886414 5:105567538-105567560 ACAACAACCAGCTCCAGGAAGGG + Intergenic
995594256 5:113731204-113731226 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
997280571 5:132641538-132641560 AATGCATCCAGCTCCAGGAAGGG + Intronic
998023288 5:138789743-138789765 ACCGCACCCGGCTGCAGGAGAGG + Intronic
998393158 5:141800735-141800757 ACAGCTGCCAGCTCCACGGAAGG - Intergenic
999571632 5:152925841-152925863 ACAGAAGCCTGCTGCAGGGGTGG + Intergenic
1001740204 5:174046863-174046885 ACAGCTGCCTGCTCCAGAAAAGG + Exonic
1001865928 5:175105399-175105421 ACAGCACCCTGCTGCAGAAGAGG + Intergenic
1001905773 5:175471847-175471869 GCAGCAACCAGTTTCAGGAGAGG + Intergenic
1002607506 5:180391735-180391757 ACAGCAGACAGGGCCTGGAGAGG - Intergenic
1002628252 5:180548565-180548587 ACAGGAGGCAGCCCAAGGAGGGG - Intronic
1003687133 6:8315325-8315347 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
1005170575 6:22980454-22980476 ACAGCAGGCAGCTGCAGCTGTGG - Intergenic
1005171704 6:22993504-22993526 TGAACAGCCAGGTCCAGGAGAGG - Intergenic
1006118950 6:31792391-31792413 GCAGCAGCCACCTCCAGGGGAGG - Exonic
1006495197 6:34417805-34417827 AAAGCATCCAGCACCAGGATTGG + Intronic
1006614604 6:35317970-35317992 ACACGCGCCAGCGCCAGGAGTGG + Exonic
1007260768 6:40561535-40561557 ACAGCAGCCAGCCCCTGTGGAGG - Intronic
1009741501 6:67752716-67752738 ACAGCAGCCGGGGCCAGGCGCGG - Intergenic
1010282982 6:74041608-74041630 ACAGCAGGCAGCCACAGCAGTGG + Intergenic
1010411655 6:75568303-75568325 ACTGCAGGCAGCCGCAGGAGTGG - Intergenic
1010775119 6:79876756-79876778 ACATCAGACACCTCCAGGATGGG + Intergenic
1013648745 6:112171996-112172018 ACAGCCGCCAGCATCAAGAGGGG - Intronic
1014045020 6:116875919-116875941 CCAGCAGCTAGATCCAGGATGGG - Intergenic
1015880260 6:137865133-137865155 ATAGCAGTCAGATGCAGGAGTGG - Intergenic
1015933137 6:138382661-138382683 AGAGCACCCACCTGCAGGAGAGG + Exonic
1016007000 6:139099352-139099374 ACAGAAGCAAGCTCCATGTGGGG - Intergenic
1016163194 6:140907469-140907491 ACAGGAGCCGGCTCCATGTGAGG + Intergenic
1017812568 6:157994601-157994623 CCAGCAGCGAGCTGCAGGAATGG + Intronic
1018336119 6:162791883-162791905 ACAGGAGCCTCCTGCAGGAGAGG - Intronic
1019107197 6:169677984-169678006 GCAGAAGCCTGCTGCAGGAGTGG + Intronic
1019377302 7:699671-699693 AGAGCGGCCAGCTGCAGGAGGGG + Intronic
1019382403 7:730866-730888 ACCCACGCCAGCTCCAGGAGGGG - Intronic
1019464442 7:1179609-1179631 ACAGCAGTCAGTGCCAGGAGCGG - Intergenic
1019490435 7:1310824-1310846 CAATCAGCTAGCTCCAGGAGAGG - Intergenic
1019687094 7:2388050-2388072 ACAGGAGACAGGGCCAGGAGCGG + Intergenic
1020413218 7:7916036-7916058 GCAGCAGCCAGCTCATGGAGAGG + Intronic
1021269901 7:18573694-18573716 ACAGGTGCCAGCTCCATGTGAGG + Intronic
1021604249 7:22394477-22394499 CCAGGAGCCTGCTCAAGGAGGGG + Intergenic
1022141831 7:27499593-27499615 AGAGCAGGCAGGTCCAGGAGGGG - Intergenic
1022250247 7:28600192-28600214 ACATCAGGGAGCTCAAGGAGAGG - Intronic
1022672739 7:32471564-32471586 GCAGCAGCCATCTCCAAGATGGG + Intergenic
1023108038 7:36782340-36782362 AGAGCAGGCAGACCCAGGAGTGG - Intergenic
1023207139 7:37763416-37763438 ACAGCAGGCAGCTGCAGCTGTGG - Intronic
1024533170 7:50409833-50409855 TCACCTTCCAGCTCCAGGAGTGG + Intergenic
1025250791 7:57350143-57350165 ATAGCAGCCACCTCCTGGGGTGG - Intergenic
1027190186 7:75992083-75992105 GCAGCACCCGGCTTCAGGAGTGG + Intronic
1027333779 7:77127006-77127028 ATCTGAGCCAGCTCCAGGAGAGG + Intronic
1027528510 7:79301072-79301094 ACAGAAGCCATCTGCAGGGGTGG + Intronic
1028069615 7:86435170-86435192 ACAGCAGCCAGTTTCAGATGTGG + Intergenic
1028358203 7:89935236-89935258 AGAGCAGAAAGCTCCAGGATGGG + Intergenic
1028884647 7:95917807-95917829 ACTGCAGCCAGCTACAGGGCCGG - Intronic
1029041417 7:97580241-97580263 ACAGCAGGCAGCTGCAGCTGTGG - Intergenic
1029782016 7:102744326-102744348 ATCTGAGCCAGCTCCAGGAGAGG - Intergenic
1030516988 7:110550789-110550811 ACAGAAGCCTGCTGCAGGGGTGG - Intergenic
1031246561 7:119320739-119320761 ACAACAGCAAGTTCCAGGAAGGG + Intergenic
1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG + Intronic
1034078741 7:148257312-148257334 ACACCAGGCACCTCCAGGACCGG + Intronic
1035001813 7:155618804-155618826 AAAACAGCCAGCGACAGGAGTGG - Intronic
1035196229 7:157222924-157222946 AATGCAGCCAGATCCAGCAGTGG - Intronic
1036847691 8:12181038-12181060 TCAGCAGCCGGCTCCTGGATGGG + Intergenic
1036869059 8:12423353-12423375 TCAGCAGCCGGCTCCTGGATGGG + Intergenic
1037956631 8:23065288-23065310 ACAGCCTCCAGCTACAGCAGGGG + Intronic
1038073656 8:24046222-24046244 ACAGCAGGCAGCTGCAGCTGTGG - Intergenic
1038546883 8:28432670-28432692 AAAGCAGACAGCTGCAGCAGAGG - Intronic
1039109495 8:34026249-34026271 ACAGATGCCTGCACCAGGAGTGG - Intergenic
1040987603 8:53313654-53313676 ACAGCAGCTCACTGCAGGAGAGG + Intergenic
1041211887 8:55559936-55559958 ACAGCAGGCAGCTGCAGCTGTGG + Intergenic
1041309623 8:56502151-56502173 CCGGCTGCCAGCACCAGGAGGGG - Intergenic
1041852301 8:62405188-62405210 TCAGCTTGCAGCTCCAGGAGAGG - Intronic
1042670661 8:71259390-71259412 CCAGTAGAGAGCTCCAGGAGTGG - Intronic
1042674439 8:71304250-71304272 ACAGCATCCACCTCCTGGGGTGG - Intronic
1043233284 8:77830066-77830088 ACAGCAGGCAGCTGCAGCTGTGG - Intergenic
1044038644 8:87337480-87337502 ACTGCAGGCAGCTTCAGCAGTGG + Intronic
1045548899 8:103152702-103152724 ACAGAAACCAACTCCAGGAATGG + Intronic
1045588557 8:103566242-103566264 ACAGAAACCAGCTACAGGAATGG - Intronic
1047215839 8:122875455-122875477 ACAGCACCCAACCCCAGGTGTGG - Intronic
1047318159 8:123753575-123753597 ACAGGAGCCAGATCAGGGAGTGG - Intergenic
1047447247 8:124930431-124930453 ACAGCAGCCCGCTCCAGCTCAGG + Intergenic
1047514756 8:125544587-125544609 CCTGCAGCCAGCTCCAGGCAGGG - Intergenic
1047994354 8:130319410-130319432 AAAGCAGCCAGTTCAAGGGGTGG + Intronic
1048223898 8:132566678-132566700 ACCTCAGCCAGCTTTAGGAGAGG + Intergenic
1049408705 8:142462978-142463000 ACACCTCCCAGCTCCAGGAGAGG - Intronic
1049749238 8:144275671-144275693 ACATCAGCCACCACCAGGGGTGG + Intronic
1049773639 8:144395005-144395027 ACAGGATCGAGCTGCAGGAGTGG - Exonic
1049817771 8:144615897-144615919 AAAGCCGCCTGCTCCAGGACAGG + Intergenic
1051462638 9:17339537-17339559 ACAGGAGCAAGCTCCAAGAATGG + Intronic
1051486957 9:17619233-17619255 ACAGCAGCCCACTCCAGCTGTGG - Intronic
1052115739 9:24646609-24646631 AGAGCAGGCAGCTGCAGCAGTGG + Intergenic
1052199743 9:25763922-25763944 ACAGCAGGCAGCCGCAGCAGTGG - Intergenic
1052702174 9:31950641-31950663 GCAGAAGCCTGCTACAGGAGTGG - Intergenic
1053117580 9:35519178-35519200 GCAGCTTCCTGCTCCAGGAGTGG - Intronic
1053549397 9:39060031-39060053 CCAGCAGCCAGGTCCAGCACTGG - Intergenic
1053813512 9:41880105-41880127 CCAGCAGCCAGGTCCAGCACTGG - Intergenic
1054617084 9:67307334-67307356 CCAGCAGCCAGGTCCAGCACTGG + Intergenic
1055135429 9:72824133-72824155 ACAGGAGCAAGCTCCATGTGGGG + Intronic
1055497379 9:76868943-76868965 ACAGCAGCAGGCTACAGAAGGGG - Intronic
1057418327 9:94885516-94885538 ACACCAGCCAGCACCAGGCCTGG - Intronic
1057443304 9:95097181-95097203 CCAGCAGCCAGCACCAGAACAGG - Intergenic
1058767205 9:108192959-108192981 GGGGCAGCCAGCTCCTGGAGGGG - Intergenic
1060147450 9:121265210-121265232 TCTGAAGCCAGCTCCAGGAGAGG + Intronic
1060343539 9:122797406-122797428 ACAGCAGCAGGGCCCAGGAGTGG - Intergenic
1060481513 9:124018959-124018981 ACAGCAGCCAGGCCCAGGCGGGG + Intronic
1061088278 9:128411947-128411969 ACTGCACCCAGAACCAGGAGTGG + Intronic
1061450134 9:130663320-130663342 ACTGCAGGCAGCTCCGCGAGAGG - Intergenic
1061684551 9:132264490-132264512 ACAGCAGCCCGCTGCTGTAGTGG - Exonic
1061776851 9:132971367-132971389 ACACCAGCCATCTCGAGAAGTGG + Intronic
1061939783 9:133877720-133877742 ACAGTAGCCATCACCTGGAGGGG + Intronic
1062129111 9:134883223-134883245 ACAGCCGCCAGCTCCAGGGTGGG + Intronic
1062138262 9:134941103-134941125 ACAGCAGCTAGTGGCAGGAGCGG + Intergenic
1190172370 X:48121793-48121815 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190197132 X:48329228-48329250 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190204830 X:48394473-48394495 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190205706 X:48400930-48400952 ACAGCTGGCAGGTGCAGGAGGGG - Intergenic
1190658656 X:52635039-52635061 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190659660 X:52642817-52642839 ACAGCTGGCAGGTGCAGGAGGGG - Intergenic
1190663871 X:52679606-52679628 ACAGCTGGCAGGTGCAGGAGGGG + Intronic
1190665887 X:52695653-52695675 ACAGCTGGCAGGTGCAGGAGGGG - Intronic
1190673531 X:52762757-52762779 ACAGCTGGCAGGTGCAGGAGGGG + Intronic
1190675551 X:52778816-52778838 ACAGCTGGCAGGTGCAGGAGGGG - Intronic
1191016480 X:55814459-55814481 ACAGGTGCCAGCTCCATGTGAGG - Intergenic
1191667470 X:63718168-63718190 GCAACAGCCACCTCCTGGAGTGG - Intronic
1192176515 X:68889489-68889511 AAATCAGCCAGCTCCATCAGTGG - Intergenic
1192198412 X:69047859-69047881 ACACCCACCAGCTGCAGGAGAGG + Intergenic
1192726954 X:73763782-73763804 ACAGCAGGCAGCCACAGCAGTGG + Intergenic
1194133148 X:90106531-90106553 AAAGCAGGCAGCTGCAGCAGTGG + Intergenic
1194972196 X:100356392-100356414 ACAGCAACCAGCTTTAGGAAAGG - Intronic
1196066634 X:111471379-111471401 ACAGAAGCCTGCTGCAGGGGTGG - Intergenic
1196324915 X:114391263-114391285 ACAGCAGCGGGCTCCAGGCCAGG - Intergenic
1197385505 X:125796384-125796406 ACAGAAGCCTGCTACAGCAGTGG + Intergenic
1197867993 X:131038746-131038768 AAAGCAGTGAGTTCCAGGAGAGG - Intergenic
1200149917 X:153946373-153946395 ACAGGTGCCAGCTACAGAAGTGG + Intergenic
1200301333 X:154979636-154979658 ACAGCAGCCTGCAGCAGCAGTGG + Intronic
1200478935 Y:3676606-3676628 AAAGCAGGCAGCTGCAGCAGTGG + Intergenic
1200755317 Y:6985206-6985228 CCAGCAGCCAGCAGCAGGACAGG + Intronic