ID: 987137890

View in Genome Browser
Species Human (GRCh38)
Location 5:14916879-14916901
Sequence CTTTATCAGCAGCAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987137887_987137890 -6 Left 987137887 5:14916862-14916884 CCCAGTCTTGGGTATGTCTTTAT 0: 2136
1: 4078
2: 7251
3: 8542
4: 9456
Right 987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG No data
987137888_987137890 -7 Left 987137888 5:14916863-14916885 CCAGTCTTGGGTATGTCTTTATC 0: 1325
1: 3282
2: 5431
3: 6676
4: 7611
Right 987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG No data
987137884_987137890 15 Left 987137884 5:14916841-14916863 CCACTTTTTCTTTATAAATTACC 0: 1415
1: 1580
2: 1055
3: 773
4: 1268
Right 987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987137890 Original CRISPR CTTTATCAGCAGCAGGAGAA TGG Intergenic
No off target data available for this crispr