ID: 987138292

View in Genome Browser
Species Human (GRCh38)
Location 5:14920057-14920079
Sequence TTCTATAAGATAGAGATGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987138288_987138292 23 Left 987138288 5:14920011-14920033 CCTTAACTGGCTTTTATTTGCAA No data
Right 987138292 5:14920057-14920079 TTCTATAAGATAGAGATGAGCGG No data
987138290_987138292 -1 Left 987138290 5:14920035-14920057 CCCAGAATCAGGCAACATCTCAT No data
Right 987138292 5:14920057-14920079 TTCTATAAGATAGAGATGAGCGG No data
987138291_987138292 -2 Left 987138291 5:14920036-14920058 CCAGAATCAGGCAACATCTCATT No data
Right 987138292 5:14920057-14920079 TTCTATAAGATAGAGATGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987138292 Original CRISPR TTCTATAAGATAGAGATGAG CGG Intergenic
No off target data available for this crispr