ID: 987141764

View in Genome Browser
Species Human (GRCh38)
Location 5:14953660-14953682
Sequence TTTCCATTGTCACAATAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987141755_987141764 29 Left 987141755 5:14953608-14953630 CCAACATTATGATCATGCCTCAG No data
Right 987141764 5:14953660-14953682 TTTCCATTGTCACAATAACCAGG No data
987141763_987141764 0 Left 987141763 5:14953637-14953659 CCTGGGGGCAGAGGCAGGTGATC No data
Right 987141764 5:14953660-14953682 TTTCCATTGTCACAATAACCAGG No data
987141760_987141764 12 Left 987141760 5:14953625-14953647 CCTCAGCAGTGTCCTGGGGGCAG No data
Right 987141764 5:14953660-14953682 TTTCCATTGTCACAATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987141764 Original CRISPR TTTCCATTGTCACAATAACC AGG Intergenic
No off target data available for this crispr