ID: 987144100

View in Genome Browser
Species Human (GRCh38)
Location 5:14974975-14974997
Sequence GGTACTGAGTTAAATGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987144100_987144103 15 Left 987144100 5:14974975-14974997 CCTGTAGCATTTAACTCAGTACC No data
Right 987144103 5:14975013-14975035 ACTGAGCAAATGTTGATTAAAGG No data
987144100_987144101 -9 Left 987144100 5:14974975-14974997 CCTGTAGCATTTAACTCAGTACC No data
Right 987144101 5:14974989-14975011 CTCAGTACCTGCTATAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987144100 Original CRISPR GGTACTGAGTTAAATGCTAC AGG (reversed) Intergenic
No off target data available for this crispr