ID: 987145734

View in Genome Browser
Species Human (GRCh38)
Location 5:14989567-14989589
Sequence CAAGTTACCTGCCTATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987145734_987145736 8 Left 987145734 5:14989567-14989589 CCAATTTATAGGCAGGTAACTTG No data
Right 987145736 5:14989598-14989620 AAAAATATTGTTTGCTTGATGGG No data
987145734_987145735 7 Left 987145734 5:14989567-14989589 CCAATTTATAGGCAGGTAACTTG No data
Right 987145735 5:14989597-14989619 TAAAAATATTGTTTGCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987145734 Original CRISPR CAAGTTACCTGCCTATAAAT TGG (reversed) Intergenic
No off target data available for this crispr