ID: 987153177

View in Genome Browser
Species Human (GRCh38)
Location 5:15061674-15061696
Sequence AACAGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987153172_987153177 11 Left 987153172 5:15061640-15061662 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG No data
987153171_987153177 15 Left 987153171 5:15061636-15061658 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG No data
987153170_987153177 16 Left 987153170 5:15061635-15061657 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987153177 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr