ID: 987154052

View in Genome Browser
Species Human (GRCh38)
Location 5:15070077-15070099
Sequence AAGGCTGGACAGGAAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987154048_987154052 1 Left 987154048 5:15070053-15070075 CCATTGGATATAAGGATCAATAA No data
Right 987154052 5:15070077-15070099 AAGGCTGGACAGGAAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987154052 Original CRISPR AAGGCTGGACAGGAAGTTGC TGG Intergenic
No off target data available for this crispr