ID: 987160173

View in Genome Browser
Species Human (GRCh38)
Location 5:15133478-15133500
Sequence CTGTCATTAGAGCTGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987160173_987160175 -6 Left 987160173 5:15133478-15133500 CCTAGCTTCAGCTCTAATGACAG No data
Right 987160175 5:15133495-15133517 TGACAGAACCATGGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987160173 Original CRISPR CTGTCATTAGAGCTGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr