ID: 987161023

View in Genome Browser
Species Human (GRCh38)
Location 5:15142834-15142856
Sequence CTGTATCCTCAGATTCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987161022_987161023 11 Left 987161022 5:15142800-15142822 CCAAGACTTTCGGAAAGGCACTT No data
Right 987161023 5:15142834-15142856 CTGTATCCTCAGATTCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987161023 Original CRISPR CTGTATCCTCAGATTCAATC AGG Intergenic
No off target data available for this crispr