ID: 987163344

View in Genome Browser
Species Human (GRCh38)
Location 5:15168400-15168422
Sequence CTTTCCGCTTAAGGATTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987163344_987163352 7 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163352 5:15168430-15168452 CTTTGGGGTCCCAGCTTTATGGG No data
987163344_987163351 6 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163351 5:15168429-15168451 CCTTTGGGGTCCCAGCTTTATGG No data
987163344_987163347 -9 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163347 5:15168414-15168436 AGCGGAAAGTAGAACCCTTTGGG No data
987163344_987163355 10 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163355 5:15168433-15168455 TGGGGTCCCAGCTTTATGGGGGG No data
987163344_987163357 15 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163357 5:15168438-15168460 TCCCAGCTTTATGGGGGGGAAGG No data
987163344_987163346 -10 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163346 5:15168413-15168435 AAGCGGAAAGTAGAACCCTTTGG No data
987163344_987163356 11 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163356 5:15168434-15168456 GGGGTCCCAGCTTTATGGGGGGG No data
987163344_987163354 9 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG No data
987163344_987163353 8 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163353 5:15168431-15168453 TTTGGGGTCCCAGCTTTATGGGG No data
987163344_987163348 -8 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163348 5:15168415-15168437 GCGGAAAGTAGAACCCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987163344 Original CRISPR CTTTCCGCTTAAGGATTAAC TGG (reversed) Intergenic
No off target data available for this crispr