ID: 987163345

View in Genome Browser
Species Human (GRCh38)
Location 5:15168409-15168431
Sequence AGGGTTCTACTTTCCGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987163345_987163356 2 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163356 5:15168434-15168456 GGGGTCCCAGCTTTATGGGGGGG No data
987163345_987163357 6 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163357 5:15168438-15168460 TCCCAGCTTTATGGGGGGGAAGG No data
987163345_987163351 -3 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163351 5:15168429-15168451 CCTTTGGGGTCCCAGCTTTATGG No data
987163345_987163354 0 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG No data
987163345_987163355 1 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163355 5:15168433-15168455 TGGGGTCCCAGCTTTATGGGGGG No data
987163345_987163352 -2 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163352 5:15168430-15168452 CTTTGGGGTCCCAGCTTTATGGG No data
987163345_987163353 -1 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163353 5:15168431-15168453 TTTGGGGTCCCAGCTTTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987163345 Original CRISPR AGGGTTCTACTTTCCGCTTA AGG (reversed) Intergenic
No off target data available for this crispr