ID: 987163354

View in Genome Browser
Species Human (GRCh38)
Location 5:15168432-15168454
Sequence TTGGGGTCCCAGCTTTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987163344_987163354 9 Left 987163344 5:15168400-15168422 CCAGTTAATCCTTAAGCGGAAAG No data
Right 987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG No data
987163345_987163354 0 Left 987163345 5:15168409-15168431 CCTTAAGCGGAAAGTAGAACCCT No data
Right 987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987163354 Original CRISPR TTGGGGTCCCAGCTTTATGG GGG Intergenic
No off target data available for this crispr