ID: 987170027

View in Genome Browser
Species Human (GRCh38)
Location 5:15245420-15245442
Sequence ATTTTTAATGGAATTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987170023_987170027 8 Left 987170023 5:15245389-15245411 CCATGGTGGGTGGAATGAGCTGC No data
Right 987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987170027 Original CRISPR ATTTTTAATGGAATTTTGGA AGG Intergenic
No off target data available for this crispr