ID: 987170558

View in Genome Browser
Species Human (GRCh38)
Location 5:15252992-15253014
Sequence ACATCACATTCAATAGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987170558_987170561 -4 Left 987170558 5:15252992-15253014 CCAAGAACTATTGAATGTGATGT No data
Right 987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG No data
987170558_987170562 4 Left 987170558 5:15252992-15253014 CCAAGAACTATTGAATGTGATGT No data
Right 987170562 5:15253019-15253041 GGAGAGGTGTGACGGATAGAAGG No data
987170558_987170563 8 Left 987170558 5:15252992-15253014 CCAAGAACTATTGAATGTGATGT No data
Right 987170563 5:15253023-15253045 AGGTGTGACGGATAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987170558 Original CRISPR ACATCACATTCAATAGTTCT TGG (reversed) Intergenic
No off target data available for this crispr