ID: 987172242

View in Genome Browser
Species Human (GRCh38)
Location 5:15270817-15270839
Sequence TTCTGCCATCCTGCTAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987172237_987172242 9 Left 987172237 5:15270785-15270807 CCCAGGACTAACCTGAAGGAAGA No data
Right 987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG No data
987172238_987172242 8 Left 987172238 5:15270786-15270808 CCAGGACTAACCTGAAGGAAGAT No data
Right 987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG No data
987172239_987172242 -2 Left 987172239 5:15270796-15270818 CCTGAAGGAAGATGAATTTTTTT No data
Right 987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG No data
987172233_987172242 26 Left 987172233 5:15270768-15270790 CCAGGACCTAGGATCATCCCAGG No data
Right 987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG No data
987172235_987172242 20 Left 987172235 5:15270774-15270796 CCTAGGATCATCCCAGGACTAAC No data
Right 987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987172242 Original CRISPR TTCTGCCATCCTGCTAAGGG AGG Intergenic
No off target data available for this crispr