ID: 987181332

View in Genome Browser
Species Human (GRCh38)
Location 5:15371740-15371762
Sequence TGCTATGGGAATTTAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987181332_987181339 24 Left 987181332 5:15371740-15371762 CCCTCCTTTAAATTCCCATAGCA No data
Right 987181339 5:15371787-15371809 AAGAGGAGAAATAACAACAATGG No data
987181332_987181338 7 Left 987181332 5:15371740-15371762 CCCTCCTTTAAATTCCCATAGCA No data
Right 987181338 5:15371770-15371792 CCTTAGATCTCTTGATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987181332 Original CRISPR TGCTATGGGAATTTAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr