ID: 987187867

View in Genome Browser
Species Human (GRCh38)
Location 5:15443939-15443961
Sequence TATTGCTTTCTGCAATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987187867_987187869 1 Left 987187867 5:15443939-15443961 CCTGTATATTGCAGAAAGCAATA No data
Right 987187869 5:15443963-15443985 TCTTCTGTCTTAATAATCCCGGG No data
987187867_987187870 2 Left 987187867 5:15443939-15443961 CCTGTATATTGCAGAAAGCAATA No data
Right 987187870 5:15443964-15443986 CTTCTGTCTTAATAATCCCGGGG No data
987187867_987187868 0 Left 987187867 5:15443939-15443961 CCTGTATATTGCAGAAAGCAATA No data
Right 987187868 5:15443962-15443984 TTCTTCTGTCTTAATAATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987187867 Original CRISPR TATTGCTTTCTGCAATATAC AGG (reversed) Intergenic
No off target data available for this crispr