ID: 987190883

View in Genome Browser
Species Human (GRCh38)
Location 5:15477198-15477220
Sequence AGGGAGAAGGAAAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987190883_987190892 6 Left 987190883 5:15477198-15477220 CCCTCCCCATTTTCCTTCTCCCT No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190883_987190893 9 Left 987190883 5:15477198-15477220 CCCTCCCCATTTTCCTTCTCCCT No data
Right 987190893 5:15477230-15477252 TCTTAAGATATAATTTTGGGTGG No data
987190883_987190894 20 Left 987190883 5:15477198-15477220 CCCTCCCCATTTTCCTTCTCCCT No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190883_987190891 5 Left 987190883 5:15477198-15477220 CCCTCCCCATTTTCCTTCTCCCT No data
Right 987190891 5:15477226-15477248 CAACTCTTAAGATATAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987190883 Original CRISPR AGGGAGAAGGAAAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr