ID: 987190892

View in Genome Browser
Species Human (GRCh38)
Location 5:15477227-15477249
Sequence AACTCTTAAGATATAATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987190885_987190892 2 Left 987190885 5:15477202-15477224 CCCCATTTTCCTTCTCCCTCTTC No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190888_987190892 -7 Left 987190888 5:15477211-15477233 CCTTCTCCCTCTTCTCAACTCTT No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190883_987190892 6 Left 987190883 5:15477198-15477220 CCCTCCCCATTTTCCTTCTCCCT No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190882_987190892 7 Left 987190882 5:15477197-15477219 CCCCTCCCCATTTTCCTTCTCCC No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190886_987190892 1 Left 987190886 5:15477203-15477225 CCCATTTTCCTTCTCCCTCTTCT No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190884_987190892 5 Left 987190884 5:15477199-15477221 CCTCCCCATTTTCCTTCTCCCTC No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data
987190887_987190892 0 Left 987190887 5:15477204-15477226 CCATTTTCCTTCTCCCTCTTCTC No data
Right 987190892 5:15477227-15477249 AACTCTTAAGATATAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987190892 Original CRISPR AACTCTTAAGATATAATTTT GGG Intergenic
No off target data available for this crispr