ID: 987190894

View in Genome Browser
Species Human (GRCh38)
Location 5:15477241-15477263
Sequence AATTTTGGGTGGATCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987190883_987190894 20 Left 987190883 5:15477198-15477220 CCCTCCCCATTTTCCTTCTCCCT No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190890_987190894 0 Left 987190890 5:15477218-15477240 CCTCTTCTCAACTCTTAAGATAT No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190882_987190894 21 Left 987190882 5:15477197-15477219 CCCCTCCCCATTTTCCTTCTCCC No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190886_987190894 15 Left 987190886 5:15477203-15477225 CCCATTTTCCTTCTCCCTCTTCT No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190887_987190894 14 Left 987190887 5:15477204-15477226 CCATTTTCCTTCTCCCTCTTCTC No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190884_987190894 19 Left 987190884 5:15477199-15477221 CCTCCCCATTTTCCTTCTCCCTC No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190888_987190894 7 Left 987190888 5:15477211-15477233 CCTTCTCCCTCTTCTCAACTCTT No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190885_987190894 16 Left 987190885 5:15477202-15477224 CCCCATTTTCCTTCTCCCTCTTC No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data
987190889_987190894 1 Left 987190889 5:15477217-15477239 CCCTCTTCTCAACTCTTAAGATA No data
Right 987190894 5:15477241-15477263 AATTTTGGGTGGATCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987190894 Original CRISPR AATTTTGGGTGGATCATCAA TGG Intergenic
No off target data available for this crispr