ID: 987193242

View in Genome Browser
Species Human (GRCh38)
Location 5:15500354-15500376
Sequence GCTCACCGCGCCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 242}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987193242_987193254 11 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193254 5:15500388-15500410 CCCGGGGCGCGGGCTGTGCGCGG 0: 1
1: 0
2: 3
3: 47
4: 420
987193242_987193246 -7 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193246 5:15500370-15500392 GGTGAGCCTCTGGGCGGCCCCGG 0: 1
1: 0
2: 1
3: 33
4: 251
987193242_987193250 0 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193250 5:15500377-15500399 CTCTGGGCGGCCCCGGGGCGCGG 0: 1
1: 0
2: 1
3: 45
4: 581
987193242_987193247 -6 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193247 5:15500371-15500393 GTGAGCCTCTGGGCGGCCCCGGG 0: 1
1: 0
2: 2
3: 28
4: 284
987193242_987193248 -5 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193248 5:15500372-15500394 TGAGCCTCTGGGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 8
4: 192
987193242_987193251 1 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193251 5:15500378-15500400 TCTGGGCGGCCCCGGGGCGCGGG 0: 1
1: 0
2: 5
3: 28
4: 280
987193242_987193256 26 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987193242 Original CRISPR GCTCACCGCGCCGCCGCCGC CGG (reversed) Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
901019760 1:6249704-6249726 GCAGCCCGCGCCGCCGCCCCGGG - Exonic
903337376 1:22634240-22634262 GCTCACCCCGCTGCAGCAGCCGG - Intergenic
904034362 1:27550991-27551013 GCTCACCGCACGGCCCCCCCGGG - Exonic
904681416 1:32232036-32232058 GCTCACCTTGCCACAGCCGCAGG + Intergenic
913959329 1:143327046-143327068 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959339 1:143327090-143327112 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959356 1:143327160-143327182 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959368 1:143327204-143327226 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959380 1:143327248-143327270 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053648 1:144152426-144152448 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053658 1:144152470-144152492 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053674 1:144152540-144152562 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053686 1:144152584-144152606 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914125433 1:144813675-144813697 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125445 1:144813719-144813741 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125457 1:144813763-144813785 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125511 1:144813957-144813979 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125523 1:144814001-144814023 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125539 1:144814071-144814093 TCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125549 1:144814115-144814137 TCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914244370 1:145874816-145874838 CTTTACCGCCCCGCCGCCGCCGG + Exonic
914531383 1:148526225-148526247 GCTCACTGCACCTCCGCCTCCGG - Intergenic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
919486885 1:198157197-198157219 GCTCGGCGCGGCGCCGCCGTCGG - Exonic
921909169 1:220528605-220528627 GCTTCCCGCGGCGGCGCCGCCGG - Exonic
923191777 1:231626902-231626924 GCTCACGCCGCCGCCGCCGGCGG - Exonic
923372335 1:233327327-233327349 TCCCACCCCGCCCCCGCCGCAGG - Intergenic
1069686783 10:70323896-70323918 GCTTACCGCCCTGCCGGCGCTGG - Exonic
1070610163 10:77927082-77927104 GGCCACAGCCCCGCCGCCGCCGG + Intergenic
1070895846 10:79982374-79982396 GCTCCCCACGGCCCCGCCGCGGG - Intronic
1075072134 10:119326451-119326473 GCTCACTGCGGGGACGCCGCAGG + Intronic
1076371781 10:129960016-129960038 GCTCAGCCCGGCTCCGCCGCTGG + Intronic
1076857610 10:133124886-133124908 GCTTTTCTCGCCGCCGCCGCTGG - Intronic
1077229125 11:1450762-1450784 GCTCACCCCGCTTCCACCGCCGG + Exonic
1077362346 11:2146257-2146279 GCTCACCGCTCCGCCGTCCGTGG + Intronic
1081549149 11:44096078-44096100 GCTGAAAGCGCGGCCGCCGCCGG - Intronic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1084174287 11:67415601-67415623 CCGCCCCGCGCCGCCCCCGCTGG + Intronic
1084273031 11:68039085-68039107 GCGCGCCGCGCCTCCGCTGCTGG - Exonic
1087046880 11:93850281-93850303 GCTCACCGCGCGCCCTCAGCCGG + Intronic
1089078855 11:115760098-115760120 GCGCCCAGCGCCCCCGCCGCGGG + Intergenic
1089810548 11:121128043-121128065 GCACACCTCCCCGCTGCCGCAGG - Exonic
1090799086 11:130159677-130159699 GCTCACCTGCCCGCCCCCGCCGG - Exonic
1092204601 12:6607294-6607316 CCTCACCCCGGAGCCGCCGCAGG + Exonic
1094552079 12:31462345-31462367 CCTCACCCCGCCCCCGCCCCTGG - Intronic
1100599072 12:96097492-96097514 GCTCACTGCACCTCCGCCTCCGG + Intergenic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1102924923 12:116819371-116819393 GCTCTGCGCGCCGCCGGCTCCGG - Intronic
1103261941 12:119595186-119595208 CCTCACCCCGCCGCCACCCCCGG - Intronic
1103400617 12:120640808-120640830 CCGCACCGCGCCGCCCCCGCCGG + Exonic
1103828734 12:123762225-123762247 GCTCGCCCCGCCGACGGCGCCGG - Intergenic
1104841572 12:131828396-131828418 GCTCTCCGCGGCGCCCCCGCCGG - Exonic
1104977853 12:132560214-132560236 ACTCACCTCGCCGGCGCCCCAGG - Intronic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1112271905 13:97976486-97976508 TCTCACCCCGCCGCGGCCGCCGG - Intronic
1113603397 13:111587411-111587433 GCTCAACGCACCACTGCCGCTGG + Intergenic
1116657928 14:47674746-47674768 GCTCCGCTCGCCGCCGCCGCCGG - Exonic
1117377381 14:55129097-55129119 ACACCCCGAGCCGCCGCCGCAGG - Exonic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122904460 14:104795478-104795500 ACTCACCGGGCCGCCGCGTCCGG + Intronic
1127606566 15:60592678-60592700 GCGCCCCGCCCCGCCCCCGCGGG + Intronic
1129644692 15:77419720-77419742 GCTCCCGGGGCCGCCGCCGAGGG + Intronic
1129823732 15:78620927-78620949 CCTCTCCGCTTCGCCGCCGCTGG + Exonic
1129933908 15:79433246-79433268 GCTCCCCGCACCGCCGGCGAGGG - Intronic
1130023619 15:80251846-80251868 GGTCTCCTCGCCGCCGCGGCAGG + Intergenic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131049065 15:89334541-89334563 GCGCACCGCGGCGCCTCTGCCGG - Intronic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132581430 16:686443-686465 GCTCACGGCTCCACCGCTGCTGG + Intronic
1132665544 16:1079916-1079938 GCGCACCGCGCCGCAGCCAACGG + Exonic
1132779297 16:1614165-1614187 GCTCCCTGCGCCGCCTCGGCCGG - Intronic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1133924764 16:10183307-10183329 GCGCTCCGCGTCGCCGCCGAGGG - Intergenic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1135712492 16:24729666-24729688 GCCGACACCGCCGCCGCCGCAGG - Intergenic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1136003542 16:27313781-27313803 GCTGTCCCCGCCGCCGCCGCCGG - Intronic
1136452089 16:30359268-30359290 GGTCAATGCGCTGCCGCCGCAGG + Exonic
1137412932 16:48244637-48244659 GCGCCGCCCGCCGCCGCCGCGGG - Intronic
1137605785 16:49786134-49786156 GCTCCCCACGCCCCCGCCTCCGG + Intronic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1140223112 16:73058194-73058216 CGGCCCCGCGCCGCCGCCGCCGG - Intronic
1140517747 16:75556340-75556362 GCTAACCCCGCCCCCGCCACTGG - Intergenic
1141683363 16:85556582-85556604 CCCCATCGCGCCGCCGCCGGGGG + Intergenic
1141828540 16:86497196-86497218 GCCGATCGCGCCGCGGCCGCCGG - Intergenic
1141830749 16:86508896-86508918 GCTCGGCCTGCCGCCGCCGCGGG - Intergenic
1141839725 16:86567030-86567052 CCTGCCCGCGCTGCCGCCGCCGG + Intergenic
1141989283 16:87601474-87601496 GCTCACCGCGCTGCGGTCACCGG + Intergenic
1142032808 16:87846864-87846886 GCTCACCGCGTCCCCGGCACGGG - Intronic
1142336163 16:89490573-89490595 GCTCCCGCCGCAGCCGCCGCTGG - Intergenic
1142367548 16:89657971-89657993 GCTCCCCGCGTCTCCGCCCCTGG + Intronic
1142413136 16:89926190-89926212 GCTCCCCCCTCCGCCGCTGCAGG - Intronic
1142623660 17:1179728-1179750 TCTGACCGAGCCGCCGCCGCGGG - Exonic
1143074817 17:4332598-4332620 GCTAACCGCTCTGCCACCGCAGG + Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147395641 17:40140557-40140579 GCGAAGCGCGCTGCCGCCGCCGG - Exonic
1148021781 17:44558177-44558199 ACTCACCACCGCGCCGCCGCCGG + Exonic
1148081049 17:44967890-44967912 GCTCAGGGCGTCGCCGCCGTCGG + Exonic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148270752 17:46260126-46260148 GCTGCCCGCGCTGCAGCCGCTGG - Intergenic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1151969864 17:77452025-77452047 GCTCCCCGCGGCGCCGGCACTGG + Intronic
1152433107 17:80260514-80260536 GCCCTGCCCGCCGCCGCCGCCGG - Intergenic
1152546784 17:81004212-81004234 GCTTCCCGCGCCGCCGCCCCGGG - Intronic
1152618016 17:81346559-81346581 GCTCCCCGCACCCCCGACGCGGG - Intergenic
1152646009 17:81468892-81468914 CCGCACCGCTCAGCCGCCGCGGG + Intergenic
1152718543 17:81911359-81911381 GCTGTCCGCGCCGCCGCTGCGGG - Exonic
1153480575 18:5543360-5543382 GCTCAGCGCGCGGCGGCAGCGGG - Intronic
1153515163 18:5895440-5895462 CCGCCCCGAGCCGCCGCCGCGGG - Exonic
1154255789 18:12779836-12779858 GTTCCCCGCGCCTCCTCCGCAGG + Intergenic
1154303995 18:13217796-13217818 GCTCCGCGCGCCGCCGCGGCCGG + Intronic
1157331298 18:46705635-46705657 GCTCACCGGGCCTCTGCCACAGG - Intronic
1157529531 18:48409493-48409515 GCGCCCCGCGCCCGCGCCGCCGG + Intronic
1158601974 18:58863660-58863682 GTTCAGCGCGGCGCCGCCGGCGG - Intronic
1159040288 18:63318419-63318441 GCTGCCCCCGGCGCCGCCGCGGG - Exonic
1159511293 18:69400925-69400947 CCCCACCGCGCCGCCGCCCCCGG - Intergenic
1160444232 18:78914593-78914615 GCTCCCCGCTGCGCCTCCGCGGG + Intergenic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1161077232 19:2291713-2291735 GCTGCCCGCGGCGCCGCCCCCGG - Exonic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1161608814 19:5229661-5229683 GCCCAGCGCGCCGCCGCGGAAGG - Exonic
1162561121 19:11418706-11418728 GCTGACTGCGCTGCCGCCGCAGG + Exonic
1165424949 19:35740428-35740450 GGTCACGGCTCCGCCGCCGCAGG + Exonic
1165775730 19:38403351-38403373 GCGCCCCGCGACGCCGCCCCCGG - Exonic
1165961640 19:39539850-39539872 GCTCCCCTGGCTGCCGCCGCCGG + Exonic
1168308973 19:55451412-55451434 TCTCCCCGCCCCGCCGCCCCTGG - Intergenic
1202693041 1_KI270712v1_random:104849-104871 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693051 1_KI270712v1_random:104893-104915 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693062 1_KI270712v1_random:104937-104959 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693073 1_KI270712v1_random:104981-105003 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693086 1_KI270712v1_random:105025-105047 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693105 1_KI270712v1_random:105094-105116 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693117 1_KI270712v1_random:105138-105160 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693129 1_KI270712v1_random:105182-105204 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693141 1_KI270712v1_random:105226-105248 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693153 1_KI270712v1_random:105270-105292 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693165 1_KI270712v1_random:105314-105336 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693177 1_KI270712v1_random:105358-105380 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693189 1_KI270712v1_random:105402-105424 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693201 1_KI270712v1_random:105446-105468 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693212 1_KI270712v1_random:105490-105512 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693224 1_KI270712v1_random:105534-105556 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693249 1_KI270712v1_random:105640-105662 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693260 1_KI270712v1_random:105684-105706 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693271 1_KI270712v1_random:105728-105750 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693282 1_KI270712v1_random:105772-105794 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
930780691 2:55222845-55222867 GCTCACCGCAACTCCGCCTCCGG - Intronic
931694232 2:64859896-64859918 CCTCTCGGCGCCGCCCCCGCTGG - Intergenic
933953354 2:87349113-87349135 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934275639 2:91571368-91571390 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
934275650 2:91571412-91571434 GCTGTCCGCCGCGCCGCCGCTGG - Intergenic
934459992 2:94208682-94208704 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934460010 2:94208752-94208774 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934460017 2:94208778-94208800 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934763938 2:96870042-96870064 GCTCCCCGCGCCACCACGGCGGG + Intronic
935622827 2:105144086-105144108 GCTCCCCGAGCCGCAGCTGCCGG - Intergenic
936278668 2:111120582-111120604 GCGCACGCCGCGGCCGCCGCCGG + Intronic
936279124 2:111122572-111122594 CCTCCCCGCGCCGCTGGCGCCGG - Intronic
937083760 2:119157871-119157893 GCCCACCACCCCGACGCCGCTGG + Exonic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
942346115 2:175004858-175004880 TCTCCCCGCGCCGCCGCAGGTGG - Intronic
943470907 2:188292513-188292535 GCTCACCGGCCCCCCGCCGCCGG - Intronic
943669985 2:190649500-190649522 GGGCTCCGCGCGGCCGCCGCCGG + Intronic
945241581 2:207681533-207681555 CCTCCCTGCGCCGCCGCCTCCGG - Intergenic
1169065677 20:2693156-2693178 GCGCCCCGCGCTGGCGCCGCGGG + Intronic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1172015530 20:31870543-31870565 GCTGCCACCGCCGCCGCCGCAGG + Exonic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1172640192 20:36436113-36436135 GCTCCACTCGCCGCCGCCGCCGG - Exonic
1172654365 20:36527998-36528020 CCACCCAGCGCCGCCGCCGCTGG + Exonic
1174017672 20:47501948-47501970 GCTCAGCCCGCAGCCGCCGCCGG - Exonic
1175429218 20:58890705-58890727 GCTCCTCGCGCCCCCGGCGCCGG - Intronic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1175783860 20:61699998-61700020 GCTCACAGCGCCGGAGCTGCAGG + Intronic
1181265466 22:21628540-21628562 CCTCACCGCGCCCACGCTGCGGG - Exonic
1181514360 22:23402659-23402681 GCTCACCTGGGCGCCGGCGCGGG + Intergenic
1182715740 22:32354881-32354903 GCTCACCTCGCTGCTGCCGTTGG - Intronic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183683773 22:39350211-39350233 GCCCGCCGCCGCGCCGCCGCCGG - Intronic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185259364 22:49853318-49853340 GCTCCCCGCGCGGCCCCCCCGGG - Intergenic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1185413432 22:50697579-50697601 GCCCCCCGCACCGCCGCCCCGGG + Intergenic
951611277 3:24494901-24494923 GCTCCCCGGGACCCCGCCGCCGG - Intronic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
954912783 3:54122671-54122693 GCTCTCGTCGCCGCCGCAGCGGG + Exonic
956681465 3:71785322-71785344 GCCCCCCGCGCCCCCGCCTCGGG + Intergenic
956867388 3:73383671-73383693 GCTCACCGCGTCGTCGTCGGTGG + Exonic
960110295 3:113838798-113838820 GCTCCGCGCGCCTCCTCCGCCGG - Exonic
963904452 3:150762655-150762677 GCCGGCCCCGCCGCCGCCGCCGG + Exonic
964201225 3:154121393-154121415 GCCGACCGCGGCGCCGGCGCCGG - Intronic
968434047 4:575980-576002 GCGCTCAGCGCCGCCGCCGTCGG - Intergenic
968835794 4:2963579-2963601 GCGCCCCTCGCCGCCGCGGCCGG - Intergenic
968879580 4:3292371-3292393 AGTCACCGCGCCGCCTTCGCGGG + Intergenic
969043763 4:4321503-4321525 GCTCACCGTGAGGCAGCCGCGGG + Exonic
970332791 4:15002876-15002898 GCTGCCCGCGCCGCCGCCGAGGG - Exonic
971372406 4:26029282-26029304 GCCCACCCTGCCACCGCCGCAGG + Intergenic
972162723 4:36245221-36245243 GCTCATTGCGCCTCCGCCTCTGG + Intergenic
976704549 4:88007527-88007549 GCTCAGCGCGCCGCGGCGGATGG + Intergenic
979455637 4:120922834-120922856 GCCCCCCGCGCCCCCGCAGCAGG - Exonic
979674813 4:123398792-123398814 GGCCACCGCGCCGCCGCTCCGGG - Intronic
982745660 4:159102875-159102897 GCTCACCTGGGCGCCGCCGAAGG + Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
983538020 4:168878329-168878351 GCTGCCCTCGCAGCCGCCGCCGG + Intronic
985580486 5:693233-693255 GCCCCCCGCGCCGCGCCCGCGGG + Intronic
985595144 5:784623-784645 GCCCCCCGCGCCGCGCCCGCAGG + Intergenic
986928950 5:12794869-12794891 CCTCAGCGCGGCGCTGCCGCAGG - Intergenic
987132480 5:14872046-14872068 GCCCTCAGCGCCGCCGCCCCCGG - Intergenic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
988823979 5:34915924-34915946 GCGCACAGAGCCGCCGCCGCAGG - Exonic
990955105 5:61332658-61332680 GCCGCCCGCGGCGCCGCCGCCGG - Exonic
992550152 5:77852022-77852044 CCTCCTCGCGCCGCCGCCGCGGG + Intronic
995764673 5:115602359-115602381 GCCCACCCCGCCGCCCCCGAGGG + Exonic
997470581 5:134114923-134114945 GCCGCCCGCGCCGCCCCCGCCGG - Exonic
997470633 5:134115139-134115161 GCTCACCTCGGCCTCGCCGCGGG - Exonic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
999767775 5:154754723-154754745 GCTCCGCGCCTCGCCGCCGCTGG - Intronic
1002415914 5:179121034-179121056 GCGCACAGCTCCCCCGCCGCAGG - Intronic
1007093232 6:39197398-39197420 GCTCACTGCGCTGCCTCCTCCGG + Intronic
1008659514 6:53651918-53651940 GCTCCCCGCGCGGCCCCAGCTGG + Exonic
1009975712 6:70668319-70668341 CCTGACCTCGCCGCCGCCTCTGG - Intronic
1011044709 6:83068100-83068122 GCGCACCGCTCCGCCCCAGCAGG - Intronic
1013106139 6:107028166-107028188 TCTCACTGCGCCGGCGCCGGCGG + Intergenic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1014230099 6:118893968-118893990 CCTCTCCGCGCCGCCGCCGGCGG + Intronic
1015880635 6:137867299-137867321 TCTCACCGCTCCGCCCCCGCGGG - Exonic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1019016574 6:168884823-168884845 GCGCAGCGCGCCGGCTCCGCGGG + Intergenic
1020105793 7:5421718-5421740 GCGCAGCGCGCCACCGCCGCCGG - Intronic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1031966463 7:128031313-128031335 GCTCTGCGGGCCGCCGCCGGAGG + Intronic
1035023065 7:155809976-155809998 CATCTCCGCGCCCCCGCCGCCGG + Intronic
1038205080 8:25458241-25458263 CCTCATCGCGCTGCCCCCGCTGG + Exonic
1039618237 8:38974161-38974183 GGCCACGGCGCCGCCTCCGCCGG - Exonic
1039892844 8:41696427-41696449 GCTCAGCACGCCGCCCCCACTGG - Exonic
1041166924 8:55101174-55101196 GCGCCCCGCGCCGCCGCCAGGGG + Intergenic
1044569391 8:93700519-93700541 GCCCCTCGCGCCGCCGCGGCAGG - Exonic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1049639333 8:143707569-143707591 GCTGACGGCGCCCCCGCCGCAGG - Exonic
1049681549 8:143920808-143920830 GCTCACCTCGCTGCAGCTGCTGG + Exonic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1053009367 9:34624633-34624655 GCAGCCCGCGCCGCCCCCGCCGG + Intronic
1053381178 9:37650798-37650820 GCCCCGCGCGCCGCCTCCGCTGG - Intronic
1054781993 9:69174195-69174217 GCTGACGCCGCCGCCGCCGCGGG + Intronic
1055612032 9:78032441-78032463 GCTCCCTGCGGCGCCGGCGCTGG + Intergenic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1057194717 9:93110618-93110640 GCTCACCGCTCCGCTGCAGGTGG - Exonic
1059208405 9:112487227-112487249 GGTCACCGCGCGGCCGCTGACGG - Intronic
1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG + Intronic
1060700482 9:125746560-125746582 GCGCCTCCCGCCGCCGCCGCCGG - Intergenic
1061261423 9:129482774-129482796 GCCCTCCGCCCGGCCGCCGCTGG - Intergenic
1061321815 9:129835603-129835625 GCTCACCGGGCCGCTGCGTCTGG - Intronic
1061859535 9:133460761-133460783 GCTCACTGCCCCGCGGCCCCAGG - Intronic
1062277234 9:135736748-135736770 GCCCACGGAGCCCCCGCCGCGGG - Intronic
1062314730 9:135961157-135961179 GAACATCCCGCCGCCGCCGCAGG + Exonic
1062411401 9:136426989-136427011 GCCCTCCCCACCGCCGCCGCCGG + Intergenic
1062549288 9:137078480-137078502 GCTCACCGCGCCTCCCTTGCAGG + Exonic
1203771058 EBV:50401-50423 GCCCACCGCGGCCCCGCCGTCGG - Intergenic
1186496467 X:10015599-10015621 GCTGTCCCCGCCGTCGCCGCCGG - Exonic
1186496502 X:10015715-10015737 TCCTTCCGCGCCGCCGCCGCGGG + Exonic
1189407113 X:40735350-40735372 GCTGCCCCCGCCGCCGCCTCCGG + Exonic
1189821588 X:44873826-44873848 GCTCTTCGCGCCGCCTCCGCTGG + Intronic
1189988458 X:46573940-46573962 ACTCTCGGCGTCGCCGCCGCCGG - Exonic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1195485887 X:105405630-105405652 CCTCATCGCGCTGCCCCCGCTGG - Intronic
1197376800 X:125690796-125690818 GCACACCCCTCCGCAGCCGCTGG + Intergenic
1197753420 X:129980435-129980457 CCTCCCCCCGCCCCCGCCGCAGG - Intergenic
1198158511 X:133985356-133985378 GCAGCCCCCGCCGCCGCCGCCGG - Exonic
1199035182 X:143041871-143041893 GCTCCCCGCCCCCCCTCCGCCGG - Intergenic