ID: 987193256

View in Genome Browser
Species Human (GRCh38)
Location 5:15500403-15500425
Sequence GTGCGCGGCGCTGCGCCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987193241_987193256 27 Left 987193241 5:15500353-15500375 CCCGGCGGCGGCGGCGCGGTGAG 0: 1
1: 0
2: 11
3: 46
4: 455
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160
987193253_987193256 -8 Left 987193253 5:15500388-15500410 CCCGGGGCGCGGGCTGTGCGCGG 0: 1
1: 0
2: 4
3: 47
4: 332
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160
987193249_987193256 4 Left 987193249 5:15500376-15500398 CCTCTGGGCGGCCCCGGGGCGCG 0: 1
1: 0
2: 2
3: 27
4: 245
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160
987193242_987193256 26 Left 987193242 5:15500354-15500376 CCGGCGGCGGCGGCGCGGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 242
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160
987193252_987193256 -7 Left 987193252 5:15500387-15500409 CCCCGGGGCGCGGGCTGTGCGCG 0: 1
1: 0
2: 2
3: 19
4: 191
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160
987193255_987193256 -9 Left 987193255 5:15500389-15500411 CCGGGGCGCGGGCTGTGCGCGGC 0: 1
1: 0
2: 3
3: 29
4: 228
Right 987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987193256 Original CRISPR GTGCGCGGCGCTGCGCCCGC CGG Exonic
900364803 1:2306774-2306796 GTCGGCGGCGCTGCGGCGGCAGG - Exonic
900599658 1:3497569-3497591 GTGAGGGGCGCTGTGCCTGCCGG - Intronic
901279947 1:8026207-8026229 GCCCGCGGCGCTGAGCCAGCCGG - Exonic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
905167017 1:36088761-36088783 GTGCGCGGCGCCGCGACTCCGGG + Intergenic
907051131 1:51330489-51330511 GCGGGCGGCGCTGCCCCAGCCGG + Intronic
913020066 1:114780490-114780512 GTCGGCGGCGCTGCACCGGCGGG - Exonic
919878725 1:201888814-201888836 CTGCGCGGAGCCGCGCCGGCTGG + Exonic
922739410 1:228006968-228006990 GAGGGCGGCGCTGCGCCAGGTGG - Intergenic
924948098 1:248859147-248859169 GTGCCCCGCGCAACGCCCGCCGG + Intergenic
1065844711 10:29735524-29735546 GGGCGCTGCGCTCGGCCCGCGGG - Intronic
1067561931 10:47310333-47310355 CTGCGCGGCTCGGCGCACGCGGG - Exonic
1070257642 10:74825554-74825576 GAGCGCGGCGCTGCGGACCCGGG + Intergenic
1072454099 10:95561236-95561258 GTGCGCGGCTCGGCCCCCGCGGG - Intronic
1072915840 10:99536953-99536975 GGGCGCAGCGCAGCGCCCCCGGG - Intergenic
1073544724 10:104338384-104338406 GCGGGCGGCGATGCCCCCGCTGG + Intronic
1077404671 11:2377698-2377720 GCGGCCCGCGCTGCGCCCGCGGG - Intronic
1078771753 11:14358582-14358604 GAGCGCGACGCTGCGGCCGCAGG + Intronic
1081860919 11:46332999-46333021 CTGCGCGCCGCGGCGCCCCCCGG - Intronic
1081981423 11:47269588-47269610 GGCCGCGCCGCGGCGCCCGCTGG - Intronic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1084979483 11:72821691-72821713 GGGCGCGGCCCTGGGCACGCTGG + Exonic
1085011112 11:73142266-73142288 GTGGGGGCCGCTGCGTCCGCCGG - Intergenic
1089051311 11:115548595-115548617 GTGCGCTGGGCTGGGCCCCCAGG + Intergenic
1091286568 11:134411766-134411788 GTGCGCGGCGGGGCGCCCGCGGG + Intronic
1092045944 12:5431987-5432009 GCGCGCGGCGCGGCGCGGGCCGG + Intergenic
1096159693 12:49366731-49366753 GTGAGCGGCGCTGTACCCGGCGG + Intronic
1096792755 12:54055089-54055111 GTGCTGGGCGCAGCGCCGGCCGG - Exonic
1097491001 12:60270068-60270090 GCGCGCGGAGCAGCGCCCGTCGG - Intergenic
1097980132 12:65729492-65729514 GCGCCCCGCTCTGCGCCCGCCGG + Intergenic
1104568346 12:129904080-129904102 GTGCGCGGAGGAGGGCCCGCCGG + Intergenic
1104692812 12:130839273-130839295 GTGCGGGGCGCGGCGCGGGCCGG - Intergenic
1104841629 12:131828592-131828614 GGGCGCGGCGCAGCCCCCGCGGG - Exonic
1104977770 12:132559957-132559979 GGGCGCGGAGCTGGGCGCGCGGG - Intronic
1105040372 12:132956349-132956371 GGGCTCGGCGGTGCACCCGCCGG + Intergenic
1106157570 13:27172002-27172024 GTGGGCGGGGCTGCGCCGCCTGG - Intergenic
1107078216 13:36346315-36346337 CTGGGCGCCGCTGCGCTCGCCGG + Intronic
1110573152 13:77027247-77027269 GGGCGCGGCCCTACTCCCGCCGG - Intergenic
1112505461 13:99972021-99972043 GAGCGGGGCGCTGCGCGCGCAGG - Intergenic
1113834593 13:113320388-113320410 GTGGGCGCCGCAGCTCCCGCTGG - Exonic
1114558511 14:23576021-23576043 GCGGGCGGCGCTGCGGCCGGGGG + Exonic
1117478378 14:56118998-56119020 GTGCCCGGCGCTGCCCCCGCTGG - Intronic
1117647182 14:57865301-57865323 GTGCGGGGCGCTGGGGACGCAGG - Intronic
1118206496 14:63728091-63728113 GGGCGGGGCGCGGCGCGCGCGGG - Intergenic
1119319193 14:73719277-73719299 GTGGGCAGCGCTGTCCCCGCTGG - Exonic
1119326097 14:73760326-73760348 GTGGGCGGCGCCGGGCCTGCTGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122065909 14:99174502-99174524 GTGCGGGGTGCTGCCTCCGCTGG + Exonic
1122577499 14:102751362-102751384 GTGCAGGGTGCAGCGCCCGCCGG + Intergenic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1124129405 15:26971238-26971260 GTGGGCGGCGCCGCGCCAGGGGG + Intergenic
1124426893 15:29570429-29570451 GGGCTAGGCGCTGCGGCCGCCGG - Intronic
1125192688 15:37011896-37011918 GTGTGAGGCACTGCGCCCGGTGG + Intronic
1128067776 15:64775358-64775380 GAGCGCGGCGCCGGCCCCGCGGG + Exonic
1129695559 15:77738986-77739008 GTGTGCGCTGCTGCGCCAGCTGG - Intronic
1132314281 15:100879344-100879366 GGGCGCGGCGCAGGGCCCGGCGG + Intronic
1132365086 15:101251457-101251479 GCCCGCGCCGCTCCGCCCGCCGG + Exonic
1132481078 16:166403-166425 GCGCGCCGCGCTGAGCCCGCTGG + Exonic
1136454024 16:30370285-30370307 GGGCGCGGCTCGGCGCGCGCCGG + Intergenic
1138106506 16:54289696-54289718 GCGCGCGCCGCAGCGCCTGCAGG - Intergenic
1138450643 16:57092131-57092153 GGGAGCGGCGCTGCGCCCTCGGG - Intergenic
1139446310 16:67000801-67000823 GTGGGCGGCGGTGGGACCGCGGG - Intronic
1139691642 16:68645509-68645531 GAGCGCGGGGCTGCGCTCCCTGG + Intronic
1142174566 16:88639235-88639257 GTGCCCGGTGCTGCGGCCGGAGG + Exonic
1142290393 16:89191562-89191584 GTGCGCAGCTCTGAGCCCCCGGG - Intronic
1142340990 16:89522557-89522579 GTCCGTGGCGCTGTGTCCGCAGG + Intronic
1142417034 16:89948815-89948837 GTGAGCGGCGCGGGGCCGGCGGG + Intronic
1142763752 17:2055158-2055180 CTGCGCTGCCCTCCGCCCGCCGG - Intronic
1142863499 17:2777166-2777188 GTGTGCAGCGCCCCGCCCGCGGG - Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1147429616 17:40363380-40363402 GAGCGTGGCGCTGCGCCTGCTGG - Exonic
1147629154 17:41918894-41918916 GTGCGCGGCGCTTCTTCCACAGG + Exonic
1151801732 17:76383289-76383311 GCGCGCGGAGCTGCGGCCCCAGG + Intronic
1152823781 17:82450742-82450764 GCGCGCGGCCCCGCCCCCGCCGG - Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155156268 18:23160431-23160453 GTGCCCGGCACTGCACCTGCAGG - Intronic
1156171746 18:34493999-34494021 CTGCGCGGCCCCGCGCCCCCGGG - Intronic
1156489149 18:37486034-37486056 GTGCTGGGCGCTGCTCCCTCAGG + Intronic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1159040682 18:63320400-63320422 GCCCGCTCCGCTGCGCCCGCGGG + Intergenic
1159241763 18:65751019-65751041 GTGCGCGCAGCTCCGCGCGCGGG - Exonic
1159241765 18:65751022-65751044 GCGCGCGGAGCTGCGCGCACTGG + Exonic
1159578273 18:70206003-70206025 GGGCCCGCCGCGGCGCCCGCTGG + Intergenic
1160548783 18:79680025-79680047 GCCCGCGCCGCTGCGCCTGCTGG + Exonic
1160722459 19:603474-603496 GTGCCCGGGGCTGGTCCCGCAGG + Intronic
1160766880 19:812716-812738 GGGCGAGGGGCTGCCCCCGCTGG - Exonic
1161233202 19:3185910-3185932 CTGCCCCGCGCGGCGCCCGCAGG + Exonic
1162754274 19:12847805-12847827 GGGCGCGGGGCTGTGCCCGAAGG - Intronic
1162951128 19:14072708-14072730 GTGCCCGGCCCTGCCCCCGGGGG + Intronic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1163453041 19:17390517-17390539 GTGCGCGCCGCGCCGGCCGCCGG + Intergenic
1166831492 19:45642182-45642204 GGGAGCGGCGCTACGCGCGCGGG - Exonic
1167307401 19:48716924-48716946 GCCCGCGGCGCTGCGCTGGCAGG - Intronic
1167995016 19:53395128-53395150 CTGCGCGAAGCTGCGCGCGCAGG - Exonic
925984981 2:9207622-9207644 GAGCGCGGAGCTGCCCCCGCCGG - Intronic
934538945 2:95159171-95159193 GTGCGCCGCGCTGGGCGCACCGG - Intronic
934966906 2:98731226-98731248 GCGCGGGGCGCGGGGCCCGCGGG - Intergenic
936038143 2:109128963-109128985 GTGCGCGGGGGTGCGCGCGGAGG - Intergenic
939613068 2:144332714-144332736 GTGCGAGGAGCCGAGCCCGCGGG - Intergenic
940751216 2:157628844-157628866 GTGCGCGGCGCTCCTGCCACTGG + Exonic
942454635 2:176129654-176129676 GGGCGCGGCGCTCCGTCCGTCGG + Intergenic
947749213 2:232524031-232524053 GTCCGCAGAGCTGCGCTCGCTGG + Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
1172765080 20:37346639-37346661 CTGCCCGGCCCTGCGCCCCCCGG + Intronic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1176194948 20:63832428-63832450 ATCCGCTGCGCTGGGCCCGCAGG - Intergenic
1176307928 21:5133989-5134011 GCGCGAGGCACTGCGCCAGCAGG - Exonic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1179243817 21:39613044-39613066 GTGCGCGGGGCAGCCCCGGCAGG - Intronic
1179849133 21:44128041-44128063 GCGCGAGGCACTGCGCCAGCAGG + Exonic
1180791518 22:18577785-18577807 GGCGGCGGCGCTCCGCCCGCCGG + Intergenic
1180791769 22:18578566-18578588 GTTCGCGGGGGTGCGCCCGCGGG - Intergenic
1181229967 22:21416743-21416765 GTTCGCGGGGGTGCGCCCGCGGG + Intergenic
1181230222 22:21417526-21417548 GGCGGCGGCGCTCCGCCCGCCGG - Intronic
1181248427 22:21517337-21517359 GGCGGCGGCGCTCCGCCCGCCGG + Intergenic
1181248682 22:21518123-21518145 GTTCGCGGGGGTGCGCCCGCGGG - Intergenic
1183219961 22:36506298-36506320 GTGCTGGGCGCTGGGCCCGCGGG - Exonic
1183220192 22:36507120-36507142 GTGCGCGGCGCGCGGCACGCCGG + Intergenic
1184067621 22:42129409-42129431 GTGGGTGGCGCGGGGCCCGCGGG - Intronic
1184537067 22:45094492-45094514 CTGCGTGGCGCTGTGGCCGCGGG - Intergenic
1185386136 22:50532012-50532034 GTGCGCCGCGATGGGGCCGCGGG + Exonic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950534333 3:13570590-13570612 GTGCGCGGCCGCGTGCCCGCCGG + Exonic
951640373 3:24829360-24829382 GTCCGCGGCGCGCCGCCCGCTGG - Intergenic
953778261 3:45841954-45841976 GTGCGCGGTGCGGCGCCTGAGGG + Intronic
954110229 3:48429409-48429431 CCGCGCGGCGCTGCCACCGCCGG + Exonic
954149102 3:48648389-48648411 GTGGGCGGCGCTGGGGCAGCGGG - Exonic
954763958 3:52897503-52897525 TTTGGCGGCGCTGCGCCGGCAGG - Exonic
966878901 3:184338691-184338713 CTGCTCGGCGCTGTGCCAGCAGG + Intronic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968879945 4:3293431-3293453 CTGCCCGGCGCCGCCCCCGCGGG - Intronic
968923166 4:3532953-3532975 CTGCGCGGCCCTGCGTCCCCGGG - Intergenic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969445855 4:7244397-7244419 GAACGCGGCGCTGCTCCTGCAGG + Intronic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
986402918 5:7396519-7396541 AGGCGCGGCGCTGGACCCGCGGG - Intronic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
992431665 5:76716274-76716296 CTGCGCGGCGCTGCTCCGGGAGG - Exonic
993285879 5:85995194-85995216 GTGCGAGGCACTGCGCCCAGCGG + Intergenic
997470648 5:134115184-134115206 CGGCGCGGCGCGGCGACCGCGGG - Intronic
1001902704 5:175444686-175444708 GCGCGCGCCGCTGCGCCCCGAGG + Intergenic
1002433312 5:179216685-179216707 GAGGGCGGCACTGCCCCCGCTGG - Intronic
1002898695 6:1393457-1393479 GTGCGCGGCGCTCTGCACACAGG - Intronic
1003107391 6:3227165-3227187 GTGCGCGGCGCTCCGCGCGAGGG - Intronic
1003604009 6:7542779-7542801 GTCCGCGCCGCAGCCCCCGCGGG + Intronic
1008013349 6:46491294-46491316 GGGGGCGGCGCGGTGCCCGCGGG + Exonic
1013232414 6:108169797-108169819 GCGCGCGGCGCGGCGGCCACCGG - Intronic
1014205541 6:118651668-118651690 GTGCGCGGCGCCGCGCGGGGCGG + Intronic
1017725772 6:157275033-157275055 GTGCGCGGTGCCGAGCGCGCGGG + Intergenic
1018013603 6:159693338-159693360 GGGCGCGGGGCGGGGCCCGCGGG - Intronic
1019595485 7:1856451-1856473 GTGGGCGGTGCTCCGCGCGCTGG - Intronic
1020118196 7:5488022-5488044 GAGCCCGGCGCTGAGCTCGCAGG - Intronic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1021998306 7:26201538-26201560 GTTCGCGGCGTGGCGCCCGGTGG - Exonic
1022101671 7:27173003-27173025 CTGCGCGGCGCGGCCCACGCGGG - Intronic
1022923266 7:35037192-35037214 GAGCCCGGCGCGCCGCCCGCCGG - Intronic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1024521091 7:50304542-50304564 GCGGGCGGCGCTGTGCGCGCGGG + Intronic
1026045676 7:66904084-66904106 TTGCTCGTGGCTGCGCCCGCGGG + Intergenic
1029207628 7:98878836-98878858 GTGGGAGGCGCAGCGCTCGCGGG + Intronic
1032306112 7:130733791-130733813 GGGCGCGGCGCCGCCCGCGCCGG + Exonic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034433213 7:151051122-151051144 GTCCGCCCCGCTCCGCCCGCGGG + Intronic
1035751909 8:2002282-2002304 GCGGGCGGCGTGGCGCCCGCGGG + Exonic
1049613696 8:143567359-143567381 GTGCCCGGGGCTGCCCCCGCGGG - Exonic
1050230897 9:3525507-3525529 GTGGGCGCCGCGCCGCCCGCCGG - Intronic
1053139880 9:35675846-35675868 CTGCCCGGCCCTGCGCCCCCTGG + Exonic
1053306222 9:36986367-36986389 GCGGCCGGCGCTGCCCCCGCCGG - Intronic
1056078325 9:83063179-83063201 CTGGGCGGAGCTGCACCCGCCGG - Intergenic
1057208078 9:93184981-93185003 GGGCGCGGCGCGGGGCCCGCGGG + Exonic
1061517068 9:131096333-131096355 ATGCGGGACGCTGAGCCCGCCGG - Intergenic
1061975960 9:134068155-134068177 GGGCGGGGCGCGGCGCCGGCGGG - Intronic
1062084682 9:134642477-134642499 GGGGGCGGCGGCGCGCCCGCGGG - Intronic
1062324602 9:136006032-136006054 GTGGGCAGAGCTGGGCCCGCGGG - Intergenic
1062364694 9:136203144-136203166 CTGCTGGGCGCTGCGCCCGCGGG + Exonic
1062491814 9:136808432-136808454 GTGGGGTGCGCTGGGCCCGCCGG + Intronic
1197941644 X:131795976-131795998 GCGCGAAGGGCTGCGCCCGCTGG + Intergenic
1198099868 X:133414600-133414622 GGGGGGAGCGCTGCGCCCGCGGG + Intronic
1198310014 X:135421760-135421782 GTGGGCGGAGCTGAGCCTGCGGG + Intergenic
1199967245 X:152830780-152830802 GGGAGCGGGGCTGCGCGCGCGGG - Intergenic
1200068695 X:153517540-153517562 GTGCGCGGCGCAGGGGCCTCGGG - Intergenic