ID: 987195703

View in Genome Browser
Species Human (GRCh38)
Location 5:15523804-15523826
Sequence GTGGACACGCAACTCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987195703_987195707 0 Left 987195703 5:15523804-15523826 CCCAGATGGAGTTGCGTGTCCAC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 987195707 5:15523827-15523849 ACCCAGCTGCAGTTGAGTCTGGG No data
987195703_987195710 8 Left 987195703 5:15523804-15523826 CCCAGATGGAGTTGCGTGTCCAC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 987195710 5:15523835-15523857 GCAGTTGAGTCTGGGAAATGCGG 0: 1
1: 0
2: 4
3: 35
4: 389
987195703_987195711 19 Left 987195703 5:15523804-15523826 CCCAGATGGAGTTGCGTGTCCAC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 987195711 5:15523846-15523868 TGGGAAATGCGGCGTTCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 85
987195703_987195706 -1 Left 987195703 5:15523804-15523826 CCCAGATGGAGTTGCGTGTCCAC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 987195706 5:15523826-15523848 CACCCAGCTGCAGTTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987195703 Original CRISPR GTGGACACGCAACTCCATCT GGG (reversed) Intronic
908984785 1:70004621-70004643 GTAGACACCCAACTGCAGCTAGG - Intronic
911437157 1:97876231-97876253 CTGGACATCCAAATCCATCTGGG + Intronic
915787490 1:158631311-158631333 GTGGCCCCCCAACTCCATCCAGG - Intronic
918087839 1:181260623-181260645 GTGGACACACAACTCCACAAAGG + Intergenic
920035697 1:203063955-203063977 GTGGACCCGCAGGTCCTTCTTGG - Exonic
1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG + Intergenic
1068521771 10:58085047-58085069 GTGGACAGGCAACAGCATCAGGG - Intergenic
1069902858 10:71715924-71715946 GTGGACACCCCATTACATCTTGG + Exonic
1070416135 10:76191304-76191326 GGGGACACTCAACACCATCCAGG - Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076606843 10:131694865-131694887 GTGGCCACACAGCTCCTTCTGGG - Intergenic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1079980931 11:27150757-27150779 GTGGACAATGAAGTCCATCTAGG - Intergenic
1083583998 11:63843334-63843356 GGGGAGAGGCTACTCCATCTGGG + Intronic
1087497017 11:98904458-98904480 GGTGACACCCAGCTCCATCTTGG - Intergenic
1088528811 11:110786048-110786070 GTAGGCACTCAACTCCAACTAGG + Intergenic
1089791172 11:120945276-120945298 GAGGGCAAGCAGCTCCATCTAGG - Intronic
1106198580 13:27515822-27515844 GGGGGCACGCAACTACAGCTAGG + Intergenic
1107447438 13:40481411-40481433 GAGGACCCACAACTCCACCTGGG + Intergenic
1108988285 13:56622587-56622609 CTGGAGACGGAACTCCAGCTAGG + Intergenic
1114823495 14:26050137-26050159 GTGGACACAAAACCTCATCTGGG - Intergenic
1119812686 14:77536070-77536092 GTGGAGACACAACTCAATTTTGG + Intronic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1129042416 15:72700855-72700877 GAGGACACACAACTCAGTCTGGG - Intronic
1136005225 16:27324748-27324770 GTCAACAGGCAACTCCATCCGGG - Intronic
1157492902 18:48136593-48136615 GTACACCCGCAACTCCCTCTCGG + Intronic
1160552557 18:79704347-79704369 GTGGACACACCACTCCACGTGGG - Intronic
1160782160 19:882637-882659 GTGGACAGGCCACGCCACCTCGG + Intronic
1162155772 19:8677240-8677262 GTGGCCAAGCCAGTCCATCTGGG - Intergenic
1165137668 19:33680110-33680132 GTGCACCCCAAACTCCATCTCGG + Intronic
1167707401 19:51089814-51089836 GTGGCCGAGCATCTCCATCTTGG - Intergenic
924979280 2:206361-206383 GTGGGCACGGAACTGAATCTTGG + Intergenic
925269021 2:2589027-2589049 GAGGCCAAGCAACTCCATCTTGG + Intergenic
927417012 2:22890361-22890383 CTGGTCAGGCCACTCCATCTGGG + Intergenic
928497767 2:31851754-31851776 GAGGTCACACCACTCCATCTTGG - Intergenic
928766084 2:34647433-34647455 GTGGACATGCAACCCAAACTAGG - Intergenic
928870238 2:35967143-35967165 GTGTGGAGGCAACTCCATCTTGG - Intergenic
932653139 2:73581689-73581711 AGGGACACACAACTCCACCTGGG - Intronic
937077617 2:119118269-119118291 GTGGACTGGCTTCTCCATCTTGG - Intergenic
1170581805 20:17704985-17705007 GTGGACACGCGACCTCAGCTGGG - Intronic
1176151037 20:63590798-63590820 GCAGACACGCCACACCATCTGGG + Intronic
1179514102 21:41894643-41894665 CTGGAGACGCAACTCATTCTGGG - Intronic
1181685875 22:24527705-24527727 GTGGCCAGGCAGCTCCATCAGGG - Intronic
1184562012 22:45268882-45268904 GTGCCCACCCAACTCCATCCTGG - Intergenic
951180340 3:19652309-19652331 GTGGGCATGCAAGTACATCTAGG + Intergenic
958658031 3:97027947-97027969 CTAGACACGCAATTCCACCTTGG - Intronic
961450584 3:127000583-127000605 CTGGACCCGCAACTGCACCTGGG - Intronic
961669825 3:128520877-128520899 GTGGACACACAAATCAGTCTAGG + Intergenic
979780807 4:124649806-124649828 GAGGACAAGGAACTGCATCTGGG - Intergenic
983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG + Intergenic
985264823 4:188147793-188147815 GGGGCAACGCAAATCCATCTGGG + Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
1016224132 6:141713263-141713285 GTTGACACACAACTGCCTCTTGG + Intergenic
1017269588 6:152491000-152491022 GTGGACACAAAACTCCAGCGTGG + Intronic
1017447704 6:154523122-154523144 GTAGACACTCAACTCCTTGTTGG - Intergenic
1018856487 6:167678807-167678829 GGGGACACGCAGCACCAACTCGG - Intergenic
1019699753 7:2468921-2468943 GTGGACCCGCATTTCCAGCTCGG - Intergenic
1027352578 7:77326987-77327009 GTGGGCTGGCAACTCCTTCTGGG + Intronic
1040389938 8:46941192-46941214 GTGGCCAGGAAACTCCAACTGGG + Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1055694545 9:78869917-78869939 CTGCACAAGCAACTGCATCTGGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1196089406 X:111723703-111723725 GTAGACACTGAACTCCATTTGGG + Intronic
1198326428 X:135578258-135578280 GTGGACATGCATCTCCACTTAGG + Intronic