ID: 987200994

View in Genome Browser
Species Human (GRCh38)
Location 5:15578021-15578043
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987200992_987200994 -8 Left 987200992 5:15578006-15578028 CCTTGTTTATGGGATGTGTGGTC 0: 1
1: 0
2: 0
3: 6
4: 117
Right 987200994 5:15578021-15578043 GTGTGGTCATGGATGTAACACGG No data
987200986_987200994 22 Left 987200986 5:15577976-15577998 CCTGTGGGCTTTGTTCTTTGGAT 0: 1
1: 0
2: 0
3: 24
4: 182
Right 987200994 5:15578021-15578043 GTGTGGTCATGGATGTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr