ID: 987206802

View in Genome Browser
Species Human (GRCh38)
Location 5:15635677-15635699
Sequence ATGAAGATGGAGAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 996
Summary {0: 1, 1: 5, 2: 23, 3: 123, 4: 844}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987206799_987206802 1 Left 987206799 5:15635653-15635675 CCTGTGTGTATTTACAGCATAGT 0: 1
1: 0
2: 0
3: 10
4: 186
Right 987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG 0: 1
1: 5
2: 23
3: 123
4: 844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987206802 Original CRISPR ATGAAGATGGAGAAGTAGGC AGG Intronic
900317714 1:2067681-2067703 GTGAAGATGGAGAAACAAGCGGG - Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901275327 1:7986752-7986774 GTGAAGTTGGAGAGGTAGCCAGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901774671 1:11552100-11552122 ATAAAGTTGGAGAAGTGGGAGGG + Intergenic
901776838 1:11565890-11565912 ATGAAGATGGAGGCGGAGACGGG + Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903314150 1:22487877-22487899 ATGAATCTGGAGAGGCAGGCAGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903677948 1:25077113-25077135 ATGAGGCTTGGGAAGTAGGCAGG - Intergenic
903913115 1:26743158-26743180 ATGAAGTTGCAGAGGTATGCTGG - Intronic
904162954 1:28534947-28534969 ATGGGGATGGAGAAGTGGGCAGG - Intronic
904177979 1:28644779-28644801 ATGAGTTTGGAGAGGTAGGCAGG + Intergenic
904263714 1:29305747-29305769 ATGAGGCTGAAGAGGTAGGCAGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905485952 1:38296702-38296724 ATGAAACTGGAGAGGCAGGCAGG - Intergenic
905562475 1:38938399-38938421 ATGAAGGTGGATAAATAGGCAGG - Intronic
905623864 1:39473934-39473956 ATGAAGATGGAGAAGGTATCAGG + Intronic
905648857 1:39643252-39643274 ATGAAGCTGGAGAGATGGGCAGG - Intergenic
905835033 1:41111313-41111335 ATGATGTTGGAGAAGTGGACAGG - Intronic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
905937321 1:41834949-41834971 ATGAAGCTGGAGCAGCAGGCAGG + Intronic
905945829 1:41900836-41900858 GTGAGGCTGGAGAAGTAGGCAGG + Intronic
906113736 1:43341602-43341624 ATGAAGCTGAAGAAGTACGTAGG - Intronic
906400593 1:45501425-45501447 ATATAGAGGGAGAAGTAGGTTGG + Intronic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
906562021 1:46765301-46765323 ATGAAGAGGGATAATTAGGTAGG - Intronic
906620230 1:47270973-47270995 ATAAAGATTGAGAAATTGGCTGG - Intronic
906967587 1:50473690-50473712 ATGACCTTGGAGCAGTAGGCAGG + Intronic
907233785 1:53025894-53025916 ATGAAATTGGAGAACTAGGCAGG - Intronic
907263037 1:53236432-53236454 ATGAGGCTGGAAAAGCAGGCAGG - Intronic
907702710 1:56804882-56804904 ATGAAGCTGGAGCTGTAGACAGG - Intronic
907760626 1:57355303-57355325 AGGAAGATAGATAAGTAGGTAGG - Intronic
907903427 1:58762470-58762492 ATGAAGCTGGAGGAGTAAGAAGG + Intergenic
907930912 1:58999182-58999204 TTGAAGATGAGGAATTAGGCTGG + Intergenic
907937439 1:59055380-59055402 CTGAAGTTGGAGAAGTTAGCAGG + Intergenic
908328761 1:63049691-63049713 ATGCAGCTGGAGAGGTGGGCAGG + Intergenic
908562047 1:65316240-65316262 ATAAAGATGGAGGTGCAGGCTGG - Intronic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909125883 1:71668814-71668836 ATAAGGATGGAGAGCTAGGCAGG + Intronic
909186506 1:72493272-72493294 ATGAAGTCAGAGAAATAGGCAGG + Intergenic
909341669 1:74538892-74538914 TTGAAGTTTGAGAAGTAGGAAGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
910258399 1:85272910-85272932 ATTAAGCTGGAGAGGTAGGTAGG - Intronic
910326375 1:86012811-86012833 ATGAAGTTGGAAAAGTAGGCAGG - Intronic
910377435 1:86587781-86587803 ATGAAACTGGAGAAATAAGCTGG - Intergenic
910539416 1:88338389-88338411 ATAAAGATGTAGAAGTATACTGG + Intergenic
910820933 1:91345395-91345417 ATGTAGTTAGAGAAATAGGCAGG + Intronic
911069667 1:93822690-93822712 ATGAGGCTGGAGGAGCAGGCAGG + Intronic
911542490 1:99174800-99174822 ATGAAGCTAGAGAAATAAGCAGG - Intergenic
911670077 1:100597928-100597950 ATGTAGTTTGAGAACTAGGCAGG + Intergenic
911698686 1:100925289-100925311 ATAAAGTTGGAGAAATAGGCTGG + Intronic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912145040 1:106783326-106783348 ATGAAGATCGAAAGGTAGGATGG + Intergenic
912341912 1:108924783-108924805 ATGAGGATGGAGAAGTAATCAGG + Intronic
912424068 1:109570759-109570781 ATGAGGGTGAAGAGGTAGGCAGG + Intronic
912791587 1:112657258-112657280 ACAAAGAAGGAGAAATAGGCCGG - Intronic
913219283 1:116646326-116646348 AGGAAGATGGAGAATTGGGGGGG + Intronic
913703287 1:121395897-121395919 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
913979461 1:143497061-143497083 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914073865 1:144322711-144322733 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914105289 1:144643649-144643671 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
914433210 1:147638593-147638615 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
914433826 1:147642524-147642546 GTGAAGCTGGAGAGGTATGCAGG + Exonic
914712255 1:150225365-150225387 ATGAAGCTGGAGGAGAAAGCAGG + Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915704309 1:157829157-157829179 ATGAGGTTGGAGGAGTAGGCAGG + Intergenic
916086262 1:161272100-161272122 ATGAATATGTACAATTAGGCAGG - Intronic
916144875 1:161729441-161729463 ATGAATATGGGGAAGTAGGAAGG + Intergenic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
916344427 1:163771782-163771804 ATGAAAGTGGAAAAGCAGGCAGG + Intergenic
916455110 1:164962993-164963015 ATGAAGCTGGAGTGGTGGGCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916699092 1:167272605-167272627 AGGAAGAGAGAGAAGTAGGAGGG + Intronic
917277969 1:173351120-173351142 GTGAGGCTGGAGAGGTAGGCAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917493347 1:175517366-175517388 GTGCAGATGGAGGAATAGGCAGG + Intronic
917834888 1:178933679-178933701 ATAAAGTTGGAAAAGTAGGTTGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918177765 1:182060439-182060461 ATGAAGAGGGAGCAGTATGGAGG + Intronic
918212714 1:182365812-182365834 ATGAAGCTGGAGAAGCAGGGAGG + Intergenic
918405228 1:184205701-184205723 ATGAATCTGGAAAGGTAGGCGGG + Intergenic
919520186 1:198578652-198578674 ATTAAGATAGACAAATAGGCTGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919959795 1:202455161-202455183 ATGAAGCTTGAGGAGTAGGTAGG + Intronic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920235836 1:204504183-204504205 ATGAAGATGGACAGGAAAGCAGG - Intergenic
920389371 1:205589369-205589391 ATGAGGATGGGGAAGTAAACAGG + Intronic
920433002 1:205930656-205930678 AAGAGGATGGAAAAGTAGGCAGG - Intronic
920638368 1:207727431-207727453 AAGAATATGAAAAAGTAGGCAGG - Intronic
920845329 1:209588752-209588774 ATGAAGCTGGAAAAGGAGGAAGG + Intronic
920979782 1:210822325-210822347 ATGAGGATGGAGAGGCAGGCAGG + Intronic
921018875 1:211217834-211217856 ATAAGGATGGAGAGGCAGGCGGG + Intergenic
921245464 1:213234645-213234667 AGGCTGTTGGAGAAGTAGGCAGG + Intronic
921550353 1:216527807-216527829 ATGAAGATGAAGACATAAGCAGG + Intronic
921836163 1:219781218-219781240 ATGTAGACAGTGAAGTAGGCTGG - Intronic
921883130 1:220276303-220276325 AAGAAGATGTAGAAGTATGTGGG + Intergenic
922399009 1:225232528-225232550 ATGAATCTGGAAAGGTAGGCAGG - Intronic
922599916 1:226842665-226842687 TTAAAAATGGAAAAGTAGGCCGG - Intergenic
923482159 1:234395745-234395767 ATGAAGAGTGAGAAGAAGACTGG + Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
923764752 1:236882687-236882709 TTCAAGATGGTGAAGGAGGCCGG - Intronic
924553247 1:245097905-245097927 ATGAGGACGGAGAGGTGGGCAGG + Intronic
924743918 1:246815109-246815131 ATGAAGTTGGAGAGGTAGGTGGG + Intergenic
924910423 1:248506157-248506179 ATGAACATGGAGAAGACAGCAGG - Intergenic
924913677 1:248541882-248541904 ATGAACATGGAGAAGACAGCAGG + Intergenic
1063436040 10:6032394-6032416 AAGAAAATGAAAAAGTAGGCAGG + Intronic
1063847717 10:10149791-10149813 ATGAAGAGGGAGGAGTGGGATGG - Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064127856 10:12679837-12679859 AGGATGATGGAGAATTAGCCAGG - Intronic
1064376089 10:14797516-14797538 ATAAAGATAGACACGTAGGCCGG + Intergenic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1065145228 10:22761910-22761932 ATGAAGAGGGGGAGGTGGGCAGG + Intergenic
1065217848 10:23467469-23467491 GTGAAGTTGGAGATGTGGGCAGG + Intergenic
1065562156 10:26974634-26974656 ATAAACATGCAGAGGTAGGCCGG - Intergenic
1065646014 10:27834605-27834627 ATAACGATGGAGAGGCAGGCAGG + Intronic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1066114548 10:32227931-32227953 AAGAAGATGGAAAAGCAGACTGG - Intergenic
1067193100 10:44089097-44089119 ATGAAGAGGTAGAAGTAGCAGGG + Intergenic
1067561337 10:47306890-47306912 ATAAAGTTGCAGAGGTAGGCAGG + Intronic
1068867158 10:61906377-61906399 AGGAAAATGGCAAAGTAGGCGGG + Intronic
1068976258 10:63013377-63013399 ATGAGGTTGGAGAGCTAGGCTGG + Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069427848 10:68305407-68305429 ATCATGATGGAGAACTGGGCTGG - Intronic
1069470752 10:68687197-68687219 ATAAAAAAGGATAAGTAGGCCGG - Intronic
1069720274 10:70545208-70545230 GTGATGCTGGAGAGGTAGGCTGG + Intronic
1070421725 10:76244002-76244024 ATGAAGATGGAGGTAGAGGCTGG + Intronic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1070829136 10:79407990-79408012 ATGATCATGGAGCAGGAGGCCGG + Intronic
1070928565 10:80243393-80243415 AGGGAGATGGAGATGAAGGCAGG + Intergenic
1071711820 10:88057345-88057367 AGAAAACTGGAGAAGTAGGCAGG + Intergenic
1071995375 10:91143142-91143164 ATGAGGTTAGAGAAATAGGCAGG + Intergenic
1072253932 10:93602506-93602528 AAAAAGATGGAGAAGCAGGGGGG - Intronic
1072314024 10:94184303-94184325 GTTAAGTTGGAGAAGTAGGCAGG - Intronic
1072557168 10:96528807-96528829 ATGAAGTTGGAGAAGTGAACAGG + Intronic
1072615903 10:97048809-97048831 ATGCAGGTGGACAGGTAGGCAGG + Intronic
1072615918 10:97048873-97048895 ATGCAGGTGGACAAGTAGGCCGG + Intronic
1072784701 10:98271779-98271801 ATGAAGTTGGGGAAGTGGGGAGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073024920 10:100480867-100480889 ATAAAGATGGGGAAATAGGATGG + Intronic
1073029979 10:100518189-100518211 ATGAAGTTGAAGTGGTAGGCTGG - Intronic
1073258593 10:102171773-102171795 ATGAAGCTAGAGAGGTAGGCAGG + Intergenic
1073838736 10:107473913-107473935 CTGAAAATGTAGAAGTAGGTAGG + Intergenic
1073937520 10:108651306-108651328 AAGAAGATGGAGAAATAAACAGG - Intergenic
1074234394 10:111570385-111570407 ATGAAGCTTTAGAACTAGGCAGG + Intergenic
1074562065 10:114543739-114543761 ATGATGCTGGAGAAGTGGGCAGG - Intronic
1074683523 10:115934985-115935007 ATGAAGAGGAAGAAGTACACTGG - Intronic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1075132424 10:119751460-119751482 ATAAAGCTGGAGAGGCAGGCAGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075502174 10:122985131-122985153 ATGAAGTTGGAGAATTAATCTGG - Intronic
1076129824 10:128005935-128005957 ATGAAGATGGAGGTGGAAGCTGG - Intronic
1076331462 10:129673348-129673370 AGGAAGATGGGGAGGTGGGCAGG - Intronic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1076494497 10:130888080-130888102 ACGCAGATGGAGGAGGAGGCAGG + Intergenic
1076592101 10:131590585-131590607 ATGATGGTGGAGAGTTAGGCTGG - Intergenic
1076820933 10:132939251-132939273 AGGAAGATGGAGGAGAAGGGAGG + Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077171574 11:1168638-1168660 CTGAAGATGGTGACGTTGGCTGG - Exonic
1077513410 11:2984659-2984681 ATGAGTATGGGGAAGTAGACAGG - Intronic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1078633761 11:13030136-13030158 ATGAGGCTGAAGAAGTAGGTGGG + Intergenic
1078717235 11:13851819-13851841 ATAAAGATGGAAAAGCAGGTGGG - Intergenic
1078757501 11:14224759-14224781 ATGAGGCCGGAGAAGTAGGTGGG + Intronic
1078828500 11:14954867-14954889 ATGAAGGTGGAGCAGTAGTCAGG + Intronic
1079192542 11:18292488-18292510 TTGAAATTGAAGAAGTAGGCTGG - Intronic
1079438770 11:20486758-20486780 ATGAAGCTGGACAACTTGGCTGG + Intronic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1079496751 11:21052877-21052899 ATGAAGTTGGAATGGTAGGCAGG + Intronic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080349982 11:31372549-31372571 ATGAACCTGGAAAAGTAGACTGG + Intronic
1080599000 11:33803738-33803760 ATCAAGATGGAGCAGGTGGCCGG + Intergenic
1080805842 11:35652674-35652696 ATGAAGTTGGAGAGGTAAACAGG + Intergenic
1081263940 11:40995835-40995857 ATGAATTTGGAGATATAGGCTGG - Intronic
1081784036 11:45733755-45733777 ATGGAGCTGGAGATGCAGGCAGG - Intergenic
1081800921 11:45858803-45858825 ATGAAGATGGCCAAGGAGGCTGG + Exonic
1081895485 11:46582151-46582173 ATGAGGATAGAGACTTAGGCAGG - Intronic
1082059310 11:47847070-47847092 CTGAGGCTGGAGAGGTAGGCAGG - Intronic
1082743676 11:56939201-56939223 ATGGAGTGGGAGAAGTAGGGAGG - Intergenic
1082902827 11:58274397-58274419 ATAAAGATGGGGAGGTTGGCAGG + Intergenic
1083372397 11:62192639-62192661 TTGAACAGGGAGAAGAAGGCAGG + Intronic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1083788415 11:64968135-64968157 ATGAAGATGGAGTGTTAGGCAGG + Intronic
1084595456 11:70114178-70114200 TTAAAGATGGAGAAACAGGCTGG + Intronic
1084953577 11:72679736-72679758 ATGAAGAGGGGGAAGTAGTCCGG - Intergenic
1085134781 11:74076616-74076638 ATGAAGCTAGGGAGGTAGGCAGG - Intronic
1085219708 11:74863273-74863295 ATGAGACTGAAGAAGTAGGCAGG - Intronic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1085675254 11:78511373-78511395 ATCAAGATATAGAATTAGGCTGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086021958 11:82240478-82240500 ATAAAAATGAAGAAGTAGGGAGG - Intergenic
1086044189 11:82513313-82513335 GTGAGGCTGGAGAGGTAGGCGGG + Intergenic
1086048286 11:82559090-82559112 CTGAAGATGGAAAAGTAAGCAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1086874739 11:92082015-92082037 ATGATGATAGAGAATTAGACTGG + Intergenic
1087530490 11:99375004-99375026 AAGAAAATGGAGAGCTAGGCCGG + Intronic
1087592168 11:100203854-100203876 ATGAAGTTTGATATGTAGGCTGG - Intronic
1088289356 11:108220075-108220097 ATCAAGTTGGAGAGGTAGGTAGG + Intronic
1088548611 11:110987419-110987441 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1088689696 11:112315226-112315248 ATGAACATAGAGGAGGAGGCAGG + Intergenic
1088740961 11:112766387-112766409 ATGAAAATGGACTAATAGGCTGG + Intergenic
1088789086 11:113208370-113208392 ATGAGGCTGGAGAAGAAGGCAGG - Intronic
1088977719 11:114830576-114830598 ACGAGGCTGGAGAAGTAGGCTGG + Intergenic
1089360267 11:117881124-117881146 ATGAATGTGGAGAAGTTGGTTGG - Intergenic
1089789393 11:120931854-120931876 ATGAGGCTGGAGAGGCAGGCAGG - Intronic
1089894085 11:121909872-121909894 ATGAAGTTAGAGAAGAAAGCTGG - Intergenic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1091112189 11:132979838-132979860 ATGCTGATGGAGAAGAAGGCAGG + Intronic
1091333213 11:134747087-134747109 AAGAGGATGGCGAAGCAGGCAGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1092009190 12:5095379-5095401 ATGAATGTGGAGAAGTTTGCTGG + Intergenic
1092046813 12:5437116-5437138 ATGAAGATGGAGTCGTAGAGGGG + Intronic
1092175275 12:6400466-6400488 ATGAAGCTAGAGAAGTAGGCGGG + Intergenic
1092764654 12:11841784-11841806 GTTAAGAAGGAGATGTAGGCCGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092948369 12:13477142-13477164 ATGAAGATTGAGAAGGAGCCAGG + Intergenic
1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG + Intergenic
1093647841 12:21609196-21609218 ATGAACCTGGAGAAGTGGGAAGG + Intergenic
1093706352 12:22279103-22279125 ATAGAGATTGAGAAGTAGGCTGG - Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1094428437 12:30340442-30340464 ATGAAGCTGGAGAGGTTGACAGG - Intergenic
1094582123 12:31743174-31743196 ATAAAGACAGAGAGGTAGGCAGG + Intergenic
1095138250 12:38633067-38633089 ATGAAGATGGAGAAAACTGCAGG + Intergenic
1095282974 12:40378220-40378242 ATTACAATTGAGAAGTAGGCAGG + Intergenic
1095417165 12:41989687-41989709 ATGAAGATGGAGGCAGAGGCTGG + Intergenic
1095689897 12:45075786-45075808 ACTAGGGTGGAGAAGTAGGCTGG + Intergenic
1095801541 12:46274191-46274213 ATTAAGAAGTAGAAGTGGGCCGG + Intergenic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1095866934 12:46982886-46982908 ATGAAGATGGAGATGTTGTGAGG + Intergenic
1096054488 12:48640145-48640167 ATAAGGCTGGAGAGGTAGGCTGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097914764 12:65009153-65009175 GGGAGGATGGAGAAGAAGGCAGG - Intergenic
1098005263 12:65989875-65989897 ATGAAGAAAGAGAGGTAGCCAGG + Intergenic
1098073423 12:66700324-66700346 ATGAGGCTGGGGAGGTAGGCAGG + Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1098441925 12:70528255-70528277 ATGAAGCTGGAGGAGTAAGTAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098718711 12:73866932-73866954 ATGAGGTTGGAGAATTAGGTGGG - Intergenic
1099140617 12:78969682-78969704 ATGAAGTAGGAGAAGTCAGCAGG + Intronic
1099497463 12:83368306-83368328 GAGAAGATGCAGAAGTAAGCAGG - Intergenic
1099566558 12:84255540-84255562 ATGAAGTCAGAGAAGTACGCAGG - Intergenic
1100140040 12:91606627-91606649 TTGAAGATGGATAGGAAGGCAGG + Intergenic
1101139355 12:101779137-101779159 ATGAAGATGGAGTAGTGGTGGGG - Intronic
1101139710 12:101782741-101782763 ATGAACCTGAAGAAGTAAGCAGG - Intronic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1102054950 12:109889547-109889569 ATGAAGATGGAGGCAGAGGCTGG - Intergenic
1102189585 12:110976863-110976885 GTGAAGCTGGATAGGTAGGCAGG + Intergenic
1102310440 12:111840900-111840922 ATGAGGTTGGAGATGTGGGCAGG - Intergenic
1102361535 12:112292125-112292147 ATGAAGTTGGAGACGTAGCCAGG - Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1103013610 12:117476827-117476849 ATGAAGATGGGCAAGAAGGTGGG - Intronic
1103172802 12:118836088-118836110 ATGGAGATGGACAAGAAGGCAGG - Intergenic
1103581074 12:121916002-121916024 ATGAAGCTGGAGGGGAAGGCTGG + Intronic
1103834404 12:123807610-123807632 ATGAAGCTGGAGAGGGTGGCAGG + Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104211075 12:126688925-126688947 ATGAGGATGGAGAGGTGGGCAGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104498080 12:129259480-129259502 ATGAAGTTGGAAAGGGAGGCAGG + Intronic
1104715793 12:131015402-131015424 ATGGAGATGGAGATGGAGACGGG + Intronic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1104948742 12:132429275-132429297 GTGAAAATGGGGAAGTGGGCGGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106197824 13:27509301-27509323 AGGAAGATGGAGAAGAAAACAGG - Intergenic
1106287277 13:28328874-28328896 GGGATGATGGAGAAGCAGGCGGG + Intronic
1106559730 13:30837912-30837934 TTGGAGATGGAGCAGTAGGAGGG + Intergenic
1106981337 13:35285848-35285870 ATGAAGACAGAGAGGTAGGCAGG - Intronic
1107845512 13:44508713-44508735 ATGAAGCTGCAGAGGTAAGCAGG - Intronic
1108393901 13:49974438-49974460 TTAAAGATGGAGAAACAGGCCGG - Intergenic
1108643467 13:52404932-52404954 ATTATGATTGACAAGTAGGCTGG - Intronic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1110598292 13:77342442-77342464 ATAAAGATGGCAAGGTAGGCTGG - Intergenic
1110884422 13:80615199-80615221 ATGAGGCTGGAAAAGTAAGCTGG + Intergenic
1110904404 13:80867373-80867395 ATGGAGATGGAAAAAAAGGCTGG - Intergenic
1110941521 13:81355775-81355797 AAGAAGATTGAGGAGTAGCCAGG + Intergenic
1111329308 13:86743367-86743389 ATGAAAATGCAGGAATAGGCCGG + Intergenic
1111815663 13:93149516-93149538 ATGAAGCTGGAGAACTGGTCAGG + Intergenic
1112606309 13:100910147-100910169 ATGAAGCTGGAGAGGTAGGCAGG + Intergenic
1112698523 13:101977543-101977565 AGGAAGAAGGAGGAGTAGGGAGG - Intronic
1112771008 13:102794956-102794978 ATTAAGGAGGAAAAGTAGGCTGG + Intronic
1113295715 13:108956547-108956569 ATGAGATTGGAGAAGTAGCCAGG - Intronic
1113674010 13:112195917-112195939 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113674102 13:112196299-112196321 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113966368 13:114155719-114155741 ATGAGGGTGGAGAAGTGGGGAGG + Intergenic
1114310859 14:21465775-21465797 ATGAGGTTGGAAAAGTAGGTAGG - Intronic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114975247 14:28088516-28088538 AGGAAGAGGGAGAATTAGACAGG - Intergenic
1115051625 14:29070458-29070480 ATGATGTTGAAGAAGTAGGTAGG + Intergenic
1115408469 14:33046294-33046316 GTGAAGCTGCAGAGGTAGGCAGG + Intronic
1115532453 14:34339844-34339866 GTTAAGAGGGAAAAGTAGGCCGG - Intronic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1116286976 14:42986369-42986391 ATGAAGATGAAGAACTTGTCTGG - Intergenic
1116446042 14:45013033-45013055 ATGAGGCTGGAGAGGTAGGCTGG - Intronic
1116500276 14:45612551-45612573 ATGAAGATTGGAAAGTAGGAAGG + Intergenic
1116922661 14:50596911-50596933 ATTAAGAAGAAAAAGTAGGCTGG + Intronic
1116953630 14:50900793-50900815 ATGAGGCTGGAGAGGGAGGCAGG + Intronic
1117218127 14:53573328-53573350 ATGAAGAATGAGAAGAACGCTGG + Intergenic
1117434414 14:55702448-55702470 ATGAAGAGGAAGAGGTAGGTTGG + Intergenic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1117652459 14:57921265-57921287 ATGCAGAGGGATAAGAAGGCAGG + Intronic
1117896967 14:60497042-60497064 ATGAAGATGGAGAGATAGGTAGG - Intronic
1118022321 14:61730453-61730475 ATGATGCTGAAGAAGTAGGTAGG - Intronic
1118228959 14:63929917-63929939 ATGAAGTTTTAGAGGTAGGCAGG + Intronic
1118645032 14:67830128-67830150 ATGAAGCCAGAGAAGTAAGCAGG + Intronic
1118645492 14:67834525-67834547 ATGAGGCTAGAGAAGTAAGCAGG - Intronic
1119093433 14:71805964-71805986 ATTAAGATTGAGAATTAGCCAGG - Intergenic
1119362500 14:74063042-74063064 ATGAAGTTAGAGAGGCAGGCAGG - Intronic
1119491418 14:75037133-75037155 ATGAGGCTAGAGAAGTAGGTAGG - Intronic
1119917656 14:78417206-78417228 ATGAAGCTGGACAGGTGGGCAGG - Intronic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121392480 14:93588133-93588155 ATGAGGCTGGAGAAGTAGGTTGG + Intronic
1121726133 14:96151448-96151470 GTGAAGCTGGGGAAGCAGGCAGG + Intergenic
1121804516 14:96804886-96804908 ATGGATATGGAGAAGTCAGCAGG + Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122195890 14:100085448-100085470 AGGGACATGGAGAAATAGGCTGG + Intronic
1202841430 14_GL000009v2_random:124825-124847 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1202910818 14_GL000194v1_random:115056-115078 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1123878634 15:24652446-24652468 GTGCAGATGTAGAAGTAGCCTGG + Intergenic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1124231981 15:27953617-27953639 TTGGAGGTGGAGGAGTAGGCAGG + Intronic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125534496 15:40435669-40435691 ATGAGGCTGGAGAAGTGGGTAGG - Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1125972556 15:43923617-43923639 ATGAAGCTGGAGAAATAGGCAGG + Intronic
1126506937 15:49416044-49416066 ATGAACCTGAAGAGGTAGGCAGG - Intronic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127362188 15:58253811-58253833 ATGAATATGAAGAAATAGTCTGG + Intronic
1127997489 15:64162113-64162135 TTGGAGATGAAGATGTAGGCCGG - Exonic
1128595824 15:68948342-68948364 ATTAAGAGGGAGAATCAGGCCGG + Intronic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1129690211 15:77708969-77708991 ATGAAGATGGAGGCAGAGGCTGG + Intronic
1129824312 15:78624793-78624815 ATGGTGATGGAGAGGCAGGCCGG + Exonic
1129974751 15:79812836-79812858 ATGAGGCTGGAGAAGTAGGGAGG + Intergenic
1130709109 15:86261946-86261968 ATGAGATTTGAGAAGTAGGCGGG - Intronic
1130710471 15:86275804-86275826 ATCTAGATGGAGAAGCAGCCTGG - Intronic
1131302411 15:91211062-91211084 ATGAAGTTGGAGAGGTGGGCAGG + Intronic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131879156 15:96844146-96844168 ATCAAGTTGGAGAAGGAGTCTGG + Intergenic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134296621 16:12951872-12951894 CTGAAGATGGAGAAATATGCAGG + Intronic
1134375639 16:13670285-13670307 ATGAGGCTTGAGAGGTAGGCAGG - Intergenic
1134425526 16:14140200-14140222 ATGAAAATAAAGAAGTAGTCTGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135008963 16:18856059-18856081 ATAAAGATGAGGAAGAAGGCAGG - Intronic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1136246183 16:28977576-28977598 ATGAGTGTGGAGAGGTAGGCAGG + Intronic
1136698950 16:32115558-32115580 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1136768658 16:32812270-32812292 ATGGAGATGGGGTAGAAGGCTGG + Intergenic
1136799457 16:33058858-33058880 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1137033248 16:35544169-35544191 ATGGAGATGGAGAAGCAGTCAGG - Intergenic
1137486417 16:48895177-48895199 ATGAATCTGGAGAGGCAGGCAGG + Intergenic
1137525992 16:49236762-49236784 ATGAAGATGGAGGAGGGGGGTGG + Intergenic
1137526389 16:49240087-49240109 ATAAAGTTGCAGAAGGAGGCAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556289 16:49472540-49472562 AGGAAGATGGAGGACTAGGGAGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137595644 16:49721723-49721745 ATGAAGGTGGTCAAGCAGGCTGG + Intronic
1137665793 16:50248222-50248244 AGGAAGAGGGAGAGGTGGGCGGG - Intronic
1137687343 16:50395440-50395462 ATGAGGCTGGAGAATTATGCTGG + Intergenic
1137951406 16:52787126-52787148 ATGAAGAGGGAGAAATGGGGAGG - Intergenic
1137961300 16:52884600-52884622 ATGTGGCTGGAGAAGTAGGTGGG + Intergenic
1138167712 16:54818528-54818550 ATAAAGATTAAGAAGTGGGCCGG + Intergenic
1138913468 16:61431845-61431867 ATGAAAGTGGAGAAGAAGGCCGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139179744 16:64732467-64732489 ATGAAGATGGAGAAGGTGAAGGG - Intergenic
1139656853 16:68393106-68393128 ATGAAAATGGACCAGGAGGCTGG + Intronic
1139956929 16:70697612-70697634 ATGATGATGGGGGAGTGGGCAGG + Intronic
1140237951 16:73175421-73175443 ACCAAGTTGGAGAAGCAGGCAGG - Intergenic
1140355245 16:74299688-74299710 ATAAAGATGATGGAGTAGGCCGG - Intronic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1141116508 16:81314413-81314435 ATGAAGCTGGAGAAGTCCGAAGG - Intergenic
1141280380 16:82625709-82625731 ATCAAGATGCAGCAGAAGGCAGG - Intergenic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1203071075 16_KI270728v1_random:1074378-1074400 ATGGAGATGGGGTAGAAGGCCGG + Intergenic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1144313777 17:14039322-14039344 ATGAATTTGGAAAAGTAAGCAGG - Intergenic
1144712266 17:17409616-17409638 AGGAAGAAGGAGGAGTTGGCCGG - Intergenic
1145240319 17:21237126-21237148 TTGAAGAAGGAGATGTGGGCTGG - Intergenic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1145907805 17:28525786-28525808 AGGAAGATGGAGAAGGCGGTTGG + Intronic
1146142198 17:30378131-30378153 ATGAGGTGGGAGAAGTGGGCCGG + Intergenic
1146393103 17:32441023-32441045 TCGAAGTTGGAGAAGTAGGCAGG + Intergenic
1146921865 17:36718547-36718569 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1147298464 17:39504166-39504188 AGGAAGATGGAAGAGTAGGATGG + Intronic
1147762138 17:42805617-42805639 CTGAAGATGAAGGAATAGGCTGG + Intronic
1148798458 17:50208893-50208915 ATAAGGCTGGAAAAGTAGGCTGG + Intergenic
1148891870 17:50813432-50813454 ACGGAGCTGGAGAAGTAGGCAGG + Intergenic
1148896462 17:50841949-50841971 AGGAAGATGAAAAAGCAGGCAGG + Exonic
1149050302 17:52296516-52296538 ATGAGGCTGGAGAAGTAGCCAGG + Intergenic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149257369 17:54841878-54841900 ATGAGGTTGGAAAAGTAAGCAGG - Intergenic
1149270838 17:54975728-54975750 ATAAGGTTAGAGAAGTAGGCAGG - Intronic
1149856429 17:60087118-60087140 ATGAAGCAGGAAAAGTAAGCAGG + Intergenic
1150550417 17:66204531-66204553 AAGAAGATGGAAGAGTAGGAAGG + Intergenic
1150564747 17:66328870-66328892 AAGAGGCTGGAGAGGTAGGCAGG + Intronic
1150739915 17:67771108-67771130 TTGAAGATGGTGAAGTGGGCTGG - Intergenic
1151211952 17:72550983-72551005 ATGTAAAAGGAGAAGTCGGCCGG - Intergenic
1153460919 18:5332315-5332337 ATGAAGACGGAGGAGAAGGGAGG + Intergenic
1153592273 18:6686228-6686250 AAGAGGCTGGAGAAGTAGACTGG - Intergenic
1153707635 18:7762470-7762492 ATGAAGATAAAGAGGTAGACGGG + Intronic
1154031516 18:10757407-10757429 ATGAAGATGAGGAAGAAGGCTGG + Intronic
1154227281 18:12516863-12516885 ATAAAGGTAGAGATGTAGGCAGG - Intronic
1154974775 18:21446317-21446339 ATTAAGATTGAAAAGGAGGCCGG - Intronic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156560383 18:38118629-38118651 AGGAAACTGGAGAAGTAAGCAGG - Intergenic
1157134899 18:45044652-45044674 ATGAAGCTGGGGCAGAAGGCAGG - Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1158672327 18:59487640-59487662 ATGTAGATGAACAAATAGGCAGG - Intronic
1158692872 18:59676974-59676996 ATGAAGGTGGAGAGGAAGACAGG + Intronic
1158710465 18:59832580-59832602 AGGTGGCTGGAGAAGTAGGCAGG + Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159027055 18:63192798-63192820 TTGAAAATGCAGAAGTAGACAGG - Intronic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159219534 18:65441316-65441338 ATGTATATTGAGAAGTAGCCGGG - Intergenic
1159942839 18:74421730-74421752 GTGAAGCTAGAGAAGCAGGCAGG - Intergenic
1160039274 18:75331234-75331256 AAGAAGATGAAGAAGTAGAAGGG - Intergenic
1160121120 18:76131183-76131205 ATGAGGCTGGAGAGGCAGGCAGG - Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1161312217 19:3601048-3601070 ATGAAAATGGAGGAAAAGGCCGG - Intronic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162199869 19:9012080-9012102 ATCAAGATGGAAAGATAGGCTGG + Intergenic
1162232711 19:9281079-9281101 ATGATGTTGGAGAGGTGGGCAGG + Intergenic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1164441118 19:28281691-28281713 ATGAAGAGGGAGAAGAGGGTGGG - Intergenic
1165216450 19:34277192-34277214 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
1165333151 19:35152592-35152614 GTGAGGATGGAGAAGAAAGCTGG + Intronic
1165350614 19:35273138-35273160 ACGGAGCTGGAGAAGTGGGCAGG - Intronic
1165877744 19:39021330-39021352 ATGGAGGTGGAGAGGGAGGCAGG - Intronic
1166056383 19:40291939-40291961 ATGAAGTTAGAGAAACAGGCAGG - Intergenic
1167749426 19:51370931-51370953 ATGAAGAGGGAGAGGCAGGTGGG - Intergenic
1167977246 19:53239414-53239436 ATAAAGATGAAGAATTAGGAGGG + Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168596029 19:57678169-57678191 ATGAAGATGAACAAGATGGCTGG + Exonic
1168668500 19:58222928-58222950 ATGAGGGGGAAGAAGTAGGCTGG + Intergenic
1168718841 19:58544020-58544042 GGGCCGATGGAGAAGTAGGCGGG - Intergenic
1202681428 1_KI270712v1_random:7141-7163 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
925338614 2:3117060-3117082 AGGAAGATTAAGAAGTAAGCTGG - Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926367163 2:12144000-12144022 ATGTGGCTGGAGAAGAAGGCAGG + Intergenic
926773994 2:16404150-16404172 ATGAGGATGGAGATGTTGACTGG + Intergenic
926890332 2:17634027-17634049 ATGAAGCTGGAGAGGTTTGCAGG + Intronic
927103960 2:19808457-19808479 TTGAAGATGGATCAGCAGGCAGG + Intergenic
927435165 2:23060407-23060429 ATGAAGTTGGAGACGCAGGGTGG + Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927733020 2:25492565-25492587 TTAAAGATGAAGGAGTAGGCTGG + Intronic
928026021 2:27739216-27739238 GTTAAGATGGAAAAGTAGGAAGG + Intergenic
928449603 2:31366766-31366788 AGGAAGAGGGAGATGTGGGCTGG - Intronic
928511374 2:32007144-32007166 ATGAGCCTGGAGTAGTAGGCTGG - Intronic
928776564 2:34771612-34771634 AGGAAGCTGGAGCAGTGGGCAGG - Intergenic
928991333 2:37235447-37235469 AGGAGGCTGGAGGAGTAGGCAGG + Intronic
929168146 2:38904407-38904429 ATGAAGATGAAAAAACAGGCCGG + Intronic
929588105 2:43128516-43128538 ATGAAGCTGGAGGGGCAGGCAGG + Intergenic
929622021 2:43364828-43364850 ATGAGGTTGGAGAGGTAGGCTGG + Intronic
929742813 2:44621658-44621680 ATGAAGTTGGGGAAATAAGCTGG + Intronic
930114639 2:47708061-47708083 AGGAAGCTGGAGAGGTGGGCAGG + Intronic
930171745 2:48258505-48258527 GTGAAGATGCAGAAGTGGCCAGG - Intergenic
930417779 2:51110795-51110817 ATGAGATTGGAGAATTAGGCAGG - Intergenic
930445814 2:51470806-51470828 AGTAAGGTGGAGAAGTAGGAAGG + Intergenic
931283499 2:60813896-60813918 ATGAAAATGGAAAATTAAGCTGG + Intergenic
931471014 2:62537650-62537672 ATGAGGATGGTGAGGTAAGCGGG - Intergenic
932701998 2:73998432-73998454 ACGAAGATGGAGTTGTTGGCTGG + Intronic
932716159 2:74101760-74101782 ATGAGGATGGAGCCGTGGGCTGG - Exonic
933010231 2:77052463-77052485 ATGAAAAGGGAGATGTCGGCTGG - Intronic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
934751897 2:96799197-96799219 ATGAGGATGAAGTAGTCGGCCGG - Exonic
934850649 2:97698587-97698609 ATGCAAGTGGAGAAGTAGGCTGG + Intergenic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
936446262 2:112597889-112597911 AAGAAAATGTAGAACTAGGCTGG + Intergenic
936466199 2:112753440-112753462 ACGAGGTTGGAGAGGTAGGCAGG - Intronic
936659756 2:114529479-114529501 ATGACAATGGAGAAGCAGACAGG - Intronic
937487085 2:122326458-122326480 ATGAAGGATGAGAAGAAGGCTGG - Intergenic
937536632 2:122896801-122896823 AACAAGATGGAGTAGTAGTCAGG + Intergenic
938049852 2:128158989-128159011 ATGAAGTTGGAAAGGTGGGCTGG + Intronic
938441636 2:131340003-131340025 ATCAAGCTGGAGAGGCAGGCTGG + Intronic
938571077 2:132562402-132562424 ATGAGGCTGAAGAATTAGGCAGG - Intronic
938643305 2:133305128-133305150 ATGAAGTTGGACAGTTAGGCAGG + Intronic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
939251394 2:139685377-139685399 GTGAAGTTAGAGAAGTAGGAGGG + Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939986617 2:148835085-148835107 ATGAAGATGGAGGCAGAGGCTGG - Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
941006304 2:160250741-160250763 ATGAGGCTGGAAAAGTGGGCAGG + Intronic
941389548 2:164894837-164894859 ATGAGGCTGGAGATGTAGGAGGG - Intergenic
941422862 2:165304807-165304829 ATGAAACTGGAGAAGTAGACAGG + Intronic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941982298 2:171472069-171472091 ATGATACTGGAGAGGTAGGCTGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942943272 2:181644946-181644968 ATGAGGATGCAGAGATAGGCAGG + Intronic
943306502 2:186269140-186269162 ATGAAGAGAGAGAAGTAGAAAGG + Intergenic
943497336 2:188638229-188638251 ATGAAGCTGGAAAGATAGGCAGG + Intergenic
944428454 2:199608114-199608136 ATGAAACTGGAGAGGTAGGTGGG + Intergenic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
944957916 2:204833903-204833925 ATGAATTTGGAGAGGTAGGTGGG - Intronic
945275947 2:207987780-207987802 ATGAAGATGGAGTGGAAGGCAGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945506849 2:210652242-210652264 ATGATGGTGCAGAAGTAGTCAGG + Intronic
945650621 2:212554398-212554420 ATGAATCTGGAGAGGTAGGATGG + Intergenic
946016933 2:216611521-216611543 ATGGAGCTGGAGCAGTAGGGAGG - Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947080643 2:226392081-226392103 TTCAGGATGCAGAAGTAGGCAGG - Intergenic
947454669 2:230243062-230243084 ATTAAGCTGGAGAAGTAAGCAGG - Intronic
947578562 2:231296240-231296262 ATGAAGATGATGAAGTAAGTTGG + Exonic
947705585 2:232273017-232273039 GTGAAGGTGGAGGAGTAGGCTGG - Intronic
949005303 2:241643177-241643199 AACAAGATGAAGAAGTAGGTTGG - Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1169663461 20:8006684-8006706 ATAGAGAGGGAGAAGTAGGAGGG - Intronic
1169663571 20:8007600-8007622 ATGGGGATGGAGAAGTAGCTAGG - Intronic
1169829978 20:9814155-9814177 ATGAAGTGGGAAGAGTAGGCAGG + Intronic
1170225278 20:13985256-13985278 ATGAGGCTGGAGTGGTAGGCAGG - Intronic
1170243712 20:14197256-14197278 ATCAAGAAGGAAAAGTAGCCTGG + Intronic
1170447079 20:16439427-16439449 ATGAGGTTGGAGAGGTGGGCAGG - Intronic
1170586693 20:17740136-17740158 ATGAAAATGCACATGTAGGCTGG + Intergenic
1170589192 20:17758373-17758395 ATGAAGCTGGAGAGGCAGGTGGG + Intergenic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1171209954 20:23309385-23309407 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1171993585 20:31715355-31715377 AGGAGGATGGAGAAGTAGGTGGG - Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172482822 20:35281017-35281039 TTGGTGATGGTGAAGTAGGCAGG - Intronic
1172519020 20:35555367-35555389 GTGAGGCTGGAGAAGTCGGCAGG + Intronic
1172700569 20:36851412-36851434 ATGAAGATGGAGAAGTGGACGGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173784508 20:45782937-45782959 TTGAGGTTGGAGAGGTAGGCAGG - Intronic
1173917963 20:46723692-46723714 ATGAGGCAGGAGAAATAGGCAGG - Intronic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174276747 20:49409595-49409617 ATGATAATGGAGAGGCAGGCGGG + Intronic
1174727496 20:52878267-52878289 ATGAGCCTGGAGAAGTAAGCTGG - Intergenic
1175764138 20:61581452-61581474 ATGAAGATGGAGGAGGGGCCAGG - Intronic
1175853835 20:62108317-62108339 TTGAAAAGGAAGAAGTAGGCTGG + Intergenic
1175956200 20:62610645-62610667 ATGAAGATGAGCAAGAAGGCAGG + Intergenic
1176630170 21:9129753-9129775 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1177006848 21:15684030-15684052 ATGAGACTGGAGAAGTGGGCAGG + Intergenic
1177427447 21:20941957-20941979 ATGAAATTGGATAAGTAAGCTGG - Intergenic
1177561107 21:22755440-22755462 ATAAAGATTGAGAATTAGGGAGG + Intergenic
1178307541 21:31503096-31503118 AGGAAAATGGTGAAGAAGGCTGG + Intronic
1178460968 21:32802048-32802070 ATGAGGCTGGGGATGTAGGCAGG + Intronic
1178493427 21:33068580-33068602 AGGAAGATGGAGAAATGAGCAGG + Intergenic
1178667821 21:34564343-34564365 ATGAAGCTGGAGAGGCAGGCAGG + Intronic
1178767154 21:35465250-35465272 ATGAGTATGGATATGTAGGCCGG - Intronic
1180012618 21:45060883-45060905 ATGAAACTAGAGAAGTCGGCAGG + Intergenic
1180376408 22:12097897-12097919 ATGAAAATGGCGGAGTGGGCCGG - Intergenic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1180608020 22:17075811-17075833 ACGATGATGGAGAAGCTGGCTGG + Intergenic
1180820571 22:18824382-18824404 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1181206795 22:21258854-21258876 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1182271734 22:29158138-29158160 ATGAGGCTGGAGAAGTGGGCTGG + Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182629678 22:31675598-31675620 ATAAAGATGTAAAAATAGGCTGG + Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182902477 22:33909832-33909854 ATGAAGTTGGTGAGTTAGGCCGG - Intronic
1182934647 22:34209572-34209594 ATGAAGATGGAAAGGTAGGCAGG - Intergenic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1184147035 22:42617782-42617804 ATGAGGCTGGAGAGGGAGGCGGG - Intergenic
1184928351 22:47660298-47660320 ATGAAGGTGATGAAGAAGGCAGG - Intergenic
1184948970 22:47826210-47826232 AGGACGATGGAGAATGAGGCAGG - Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1203220129 22_KI270731v1_random:36569-36591 AGGAAGATGGAGAATTGGGGTGG - Intergenic
1203270697 22_KI270734v1_random:50257-50279 AGGAAGATGGAGAATTGGGGTGG + Intergenic
949189370 3:1233312-1233334 TTGAAGATGGTGAGCTAGGCAGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949411248 3:3766807-3766829 GTGAAGATGGATAATCAGGCAGG + Intronic
949474720 3:4432490-4432512 GTTAGGTTGGAGAAGTAGGCAGG - Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
950249620 3:11453491-11453513 AAAAGGGTGGAGAAGTAGGCGGG + Intronic
950519143 3:13485969-13485991 ATTAAGATGAAGAAGTAGGCCGG + Intronic
950552409 3:13674818-13674840 ATGAAGTTGGAGAGGTGGGGTGG + Intergenic
950961985 3:17117161-17117183 ATGAACCTGGAGAAATGGGCAGG + Intergenic
951303521 3:21028293-21028315 ATGAAGTTGGTGAAGTAGGCAGG - Intergenic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
951905177 3:27699184-27699206 ATGAGATTGGAGAAGTAAGCAGG - Intergenic
952056811 3:29457157-29457179 ATGGAGGTGGAGAAGAAGGGAGG - Intronic
952498195 3:33934674-33934696 ATGAAACTGGAGAAGTAGCCAGG - Intergenic
952881588 3:37989300-37989322 CGGAAGATGGAGACTTAGGCCGG + Intronic
952948628 3:38498815-38498837 ATGATGCTGGAGAAGTAAGCAGG + Intronic
953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG + Intergenic
953370435 3:42383211-42383233 AGGAAGGTTGAGGAGTAGGCTGG - Intergenic
953466704 3:43128038-43128060 ATAAGGCTGGAGAAGTAGGCAGG + Intergenic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
954090035 3:48276928-48276950 ATTCAGATGGAGAAGAAGGGGGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955384247 3:58466485-58466507 ATAAAGATGCAGAACTAGCCAGG + Intergenic
955531268 3:59875365-59875387 ATGATGATGAAGAGGTAAGCTGG - Intronic
956321387 3:68000516-68000538 ATGAGGCTAGAGAAGTAGGTGGG + Intergenic
956681294 3:71784679-71784701 GTGATGAGGGAGAAGTAAGCGGG + Intronic
956765754 3:72482887-72482909 AGGCAGAAGGAGAAGTAGGTTGG + Intergenic
957955931 3:87187010-87187032 ATGAAGCTGGGGAAGTAGGCAGG + Intergenic
958434970 3:94085458-94085480 AAGAAGATGGAAATGTTGGCTGG + Intronic
958672622 3:97223774-97223796 ATGTGGTTGGAGAGGTAGGCAGG + Intronic
958709884 3:97705133-97705155 ATGAGGCTAGAGAAGTAAGCAGG - Intronic
958747803 3:98158438-98158460 GTGAAGTTGGAGAAGTCAGCTGG + Intergenic
958753100 3:98216206-98216228 GTGAAGTTGGAGAAGTCAGCTGG + Intergenic
958894261 3:99812734-99812756 ATGATGATGGAGAAGTAGATGGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959541125 3:107539962-107539984 ATGAGTATGTAGAATTAGGCTGG + Intronic
960419689 3:117428433-117428455 TTAAAAATGGGGAAGTAGGCTGG - Intergenic
960787012 3:121384605-121384627 ATGAGGATGGAAAAATAGGCAGG + Intronic
961470759 3:127110112-127110134 ATGAAGTTGGAGAGATGGGCTGG + Intergenic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
961987670 3:131154818-131154840 ATGAAGCTGGAGAGACAGGCAGG + Intronic
962008079 3:131368371-131368393 ATCAAGGTGGAGATGTAGGTGGG + Intergenic
962387106 3:134940460-134940482 ATGAAGCTGGAGAGGTTGCCAGG - Intronic
962452398 3:135531247-135531269 ATGAAGCTGGAGAAATAGACAGG - Intergenic
962842855 3:139251531-139251553 ATGAAGAAAGAGAAGTTGCCTGG - Intronic
963123383 3:141794492-141794514 ATGAAGATGGAGAGGTGGCAGGG + Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963627168 3:147688482-147688504 ATGATGATGGAGAAGTGGGTAGG - Intergenic
963685979 3:148434484-148434506 ATAAAGATGGAAATGTTGGCTGG + Intergenic
963819336 3:149870472-149870494 ATGATGATGCAGAAGCAAGCTGG - Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964666867 3:159184135-159184157 ATGAAGATGGAGAGGTGAGCGGG - Intronic
964716526 3:159728361-159728383 AGGAGGATGGAGAATGAGGCAGG + Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
964795467 3:160492111-160492133 AAGTAGTTAGAGAAGTAGGCAGG + Intergenic
965192519 3:165549681-165549703 ATGAAGCTGAATAAGCAGGCAGG - Intergenic
965448154 3:168801774-168801796 ATGATGATGGCGCAGTGGGCTGG + Intergenic
965879736 3:173374131-173374153 ATGAATATGGATAAGTATGCAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966755761 3:183369939-183369961 ATGAAGTTGGAGAAGTTAGTGGG - Intronic
966979464 3:185117752-185117774 GACAAGCTGGAGAAGTAGGCAGG - Intronic
966979802 3:185121665-185121687 GTGAAGTTGGAGAAGTAGTAAGG + Intronic
967710191 3:192697677-192697699 ATGAAGATGGAGATGTACTGTGG + Intronic
967780253 3:193430755-193430777 GTGAAGTTGGTGAAGTAGTCAGG + Intronic
967788118 3:193519359-193519381 ATGGAGTTGGAGAGGAAGGCAGG - Intronic
967929588 3:194681153-194681175 ATGAGGTTGGAGACATAGGCAGG + Intergenic
967983370 3:195078522-195078544 AGGAAGAGGGGGAGGTAGGCTGG - Intronic
968235698 3:197029181-197029203 ATGGAGGTGGAGACGGAGGCCGG - Intronic
968907470 4:3461377-3461399 TTGCAAATGGAGAAATAGGCTGG - Intergenic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969943221 4:10756087-10756109 ATGAGGATGGGGAGGTAGGCAGG - Intergenic
970393907 4:15645721-15645743 ATTAAGAAAGAAAAGTAGGCCGG - Intronic
970627590 4:17906345-17906367 ATGAAGCTAAAGAAGTAGGTAGG - Intronic
970722460 4:19003709-19003731 ATGAAGATGGAGAGGTGCTCAGG + Intergenic
970803358 4:20002969-20002991 ATGAGTCTGGAGAGGTAGGCAGG - Intergenic
970838005 4:20434189-20434211 ACGAAAATGGGGAAGGAGGCTGG + Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971317893 4:25582608-25582630 ATGAAGAAGGAAAAGAAGACGGG - Intergenic
971394181 4:26213585-26213607 ATGAGAATGGAAAGGTAGGCGGG + Intronic
971417197 4:26442644-26442666 AGGAAGACTGAGAAGTAGGAAGG - Intergenic
971617771 4:28814397-28814419 ATGAATATCTAGAAGCAGGCTGG + Intergenic
971722939 4:30270302-30270324 GTGAAGAAAGAGGAGTAGGCAGG - Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
973242820 4:47975858-47975880 ATGAAGGTAGAGAAGTGGGAAGG - Intronic
973399504 4:49626650-49626672 AGGAAAATGGCGAAGTGGGCCGG + Intergenic
973908052 4:55550485-55550507 ATGAGGTTGGAGAGGTAGGGAGG - Intergenic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
974919397 4:68219668-68219690 ATGATCATGGAGAATTAGTCTGG - Intergenic
975444435 4:74445759-74445781 ACAGAGATGGAGAATTAGGCAGG - Intronic
975586648 4:75956587-75956609 ATGATGTTGGAAATGTAGGCAGG + Intronic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976441574 4:85081965-85081987 ATGAAGATGTAGAAATAGCAAGG - Intergenic
976542865 4:86297910-86297932 ATGAACCTGGAGAAATAAGCAGG - Intronic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
976879234 4:89898599-89898621 ATGAGGTTGGGGAGGTAGGCAGG - Intronic
977052267 4:92143370-92143392 ATGATGTTTGGGAAGTAGGCTGG - Intergenic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977245238 4:94623249-94623271 ATGAAGCTGGAGAAGAAGGTTGG - Intronic
978460510 4:108946683-108946705 ATTATGGTGGAGAAGTTGGCGGG + Intronic
978560792 4:110031564-110031586 GTGAAGCTGGAGATGTGGGCTGG + Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979059033 4:116031138-116031160 ATGAGGATGCAGAAGTATCCAGG + Intergenic
979075889 4:116269743-116269765 ATGAAGCTCAAGAAGTAGACAGG - Intergenic
979092376 4:116501517-116501539 ATCAAGCTAGAGAAGTAGACAGG - Intergenic
979220182 4:118214225-118214247 ATGAAGATGAAGAAGAAGGTAGG + Intronic
979702701 4:123686344-123686366 ATGAAGATGGAGAGGTAGGTAGG + Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
980651012 4:135714434-135714456 ATAAAGAAGGAAAATTAGGCTGG - Intergenic
980866042 4:138554218-138554240 ATAAGGATGGAGAATTAGACTGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981141619 4:141276094-141276116 ATGAGAATGGAGAAGTATGTAGG - Intergenic
981258483 4:142691549-142691571 TTGTTGATGGAGAAGTAGACTGG - Intronic
981440379 4:144775679-144775701 ATCAAGTTGGAGATGTAGGCAGG + Intergenic
981589629 4:146345438-146345460 AAAAAGATGGAAATGTAGGCAGG - Intronic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981917629 4:150052018-150052040 CTGAGGACGGAGAGGTAGGCAGG - Intergenic
981950445 4:150400131-150400153 ATGAAGTTGGGGAAGTAAGCAGG + Intronic
982003392 4:151042135-151042157 ATTAAGTTGGAGAGGTAGGCAGG + Intergenic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982074224 4:151722473-151722495 ATGAAATTGAAGATGTAGGCAGG - Intronic
982109425 4:152040299-152040321 ATTAGGATGGAGAAGAAGCCTGG + Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983123208 4:163914972-163914994 ATAAGGCTGGAGAAATAGGCAGG + Intronic
983252550 4:165361258-165361280 AAGGAGAGGGAGAAGTAGCCAGG + Intronic
984082484 4:175265390-175265412 ATGAAAATAGGAAAGTAGGCCGG + Intergenic
984107321 4:175564459-175564481 ATGAAGATGGAGACAGAGGTTGG + Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984389150 4:179105865-179105887 ATCAAGATGGAGAAGCAGGGAGG + Intergenic
984575784 4:181446716-181446738 ATGAGGTTGGAGAGGTAGACAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
985376444 4:189344664-189344686 ATGAAGATGGAGAACAGGGAAGG + Intergenic
1202758008 4_GL000008v2_random:83330-83352 ATGAAAATGGCGGAGTGGGCCGG - Intergenic
985531121 5:434337-434359 ATCAAGATGGAGAAGGACTCTGG + Exonic
985929787 5:3047861-3047883 ATTAAGATTGAAAAGTAGCCAGG - Intergenic
985970873 5:3377478-3377500 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970882 5:3377526-3377548 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970901 5:3377623-3377645 ATGGAGATGGAGATGCAGGGAGG + Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
986220560 5:5765321-5765343 GTGATGCTGGAGATGTAGGCAGG + Intergenic
986310006 5:6544690-6544712 ATGAAGATGGAGGTGGAGACCGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987147466 5:15006193-15006215 ATGAGTGTGGAGAAGTAGGCAGG - Intergenic
987198727 5:15553174-15553196 ATGAAGCTGGACAAGAGGGCTGG - Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
988814541 5:34821083-34821105 ATGAACCTGAAGAAGTAGACTGG + Intronic
990252767 5:53933348-53933370 GTAAAGATGGAGAAAAAGGCCGG + Intronic
990474074 5:56144532-56144554 ATGAGGTTGGAGAGGGAGGCAGG + Intronic
990635577 5:57722500-57722522 AGGAGGCTGGAGATGTAGGCAGG + Intergenic
990986959 5:61649553-61649575 GTGAGGTTGGAGAGGTAGGCAGG - Intronic
991066954 5:62434053-62434075 ATGAAGTTGGAGAAAAGGGCAGG - Intronic
991410124 5:66337501-66337523 ATGAAGATGCAAGAGTATGCAGG - Intergenic
992250722 5:74873466-74873488 ATGAAGCTGCAGAAATAGGCAGG + Intergenic
992384214 5:76268110-76268132 ATGAGTGTGGAGAAGCAGGCTGG + Intronic
993262376 5:85675521-85675543 ATGAGGCTGCAGAAGCAGGCAGG - Intergenic
993407929 5:87535315-87535337 ATGAAGAAGGAGGAGTAAGTAGG - Intergenic
993852218 5:93024338-93024360 ATGAGGCTGGAGAAGTGAGCAGG + Intergenic
993930740 5:93935555-93935577 ATGAGGTTGGAGAGGTGGGCAGG + Intronic
994424736 5:99570681-99570703 ATGAGGATAGAGAGGTAGGTTGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
998078906 5:139258568-139258590 ATGAGGAAGGACAGGTAGGCAGG + Intronic
998306278 5:141080271-141080293 ATGAAGCCAGAAAAGTAGGCAGG + Intergenic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998569495 5:143244631-143244653 ATGAAGCTGGGGAAATGGGCTGG - Intergenic
998778259 5:145627793-145627815 ATTAAGTTGGTGAAGTAGCCTGG - Intronic
999630672 5:153567840-153567862 ATAAAAATAGAGAGGTAGGCTGG + Intronic
999676150 5:154004939-154004961 ATGAGGCTGGAAAAGTAGGTAGG - Intronic
1000182054 5:158821099-158821121 ATGTAGATAGGGAAGTGGGCTGG - Intronic
1001095902 5:168775331-168775353 ATGAAAATGCAGTGGTAGGCCGG - Intronic
1001132781 5:169078532-169078554 GTGAAGTTGGTGAAGTAGGAAGG - Intronic
1001241667 5:170076049-170076071 ATGAAGGTGGAGAAGGAGTACGG + Exonic
1001256661 5:170188639-170188661 ATGAGGATAGAGAAGAAGGAGGG + Intergenic
1001318902 5:170664108-170664130 ATGAGGCTGGAGACATAGGCAGG - Intronic
1002157915 5:177297245-177297267 ATGAAAGGGGAGAACTAGGCAGG - Exonic
1002376343 5:178791787-178791809 ATGATAATGTAGAAGTTGGCCGG - Intergenic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003631480 6:7791498-7791520 ATGAAGATGGAGAAGCAGAGAGG - Intronic
1003804651 6:9713614-9713636 GTGAAGCTGGAGAGGTAGGTGGG + Intronic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004535154 6:16493245-16493267 ATGAAGTTGGAAAAGCATGCTGG - Intronic
1005464119 6:26095191-26095213 ATGAAGAAAGTGAAGTAGGCCGG + Exonic
1006258639 6:32850821-32850843 ATGAAGATGGAGAATCAGTAAGG + Intronic
1006828927 6:36957196-36957218 AGGAGGATGGAGAGATAGGCAGG - Intronic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1007132132 6:39485031-39485053 TTGAAGATGGAGAAATATGCAGG - Intronic
1007912197 6:45527220-45527242 ATGAAGTTAGAGAGATAGGCTGG + Intronic
1008348012 6:50453393-50453415 ATCATGATGGAGAAATAGGCAGG - Intergenic
1008519716 6:52351574-52351596 ATGAGACTGGAGAAGTAAGCCGG - Intergenic
1008850912 6:56020279-56020301 ATGAAAATGTCAAAGTAGGCAGG + Intergenic
1008923024 6:56862538-56862560 ATGAAGATGAAGATGAAGTCTGG - Intronic
1009194252 6:60665525-60665547 AGGAAGATTGGAAAGTAGGCAGG - Intergenic
1009715633 6:67391058-67391080 ATGATGGTGGAGAAGGAGGACGG + Intergenic
1009722778 6:67496124-67496146 ATGAAGTTAGAGAAATAGGTGGG + Intergenic
1010038034 6:71348367-71348389 ATGAGGATGGAGAGGGAGGTAGG - Intergenic
1010708766 6:79146872-79146894 ATGAAGATGGAAAAGGAGAGTGG + Intergenic
1010748598 6:79592670-79592692 ATGAGGCTGGAGAAGTCGGCAGG + Intergenic
1011278277 6:85651016-85651038 ATGAATTTGGAGAAGTTAGCAGG + Intergenic
1011511397 6:88104981-88105003 ATGAGGATGAGGAAGTAGGCAGG + Intergenic
1011599385 6:89045704-89045726 ATGGAGATGGAAAAGTATGATGG + Intergenic
1012040214 6:94194765-94194787 AGGAAGATTGAGAAGGAGGTAGG - Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012684322 6:102225407-102225429 ATGTAGATGGAGATCTAGGAGGG + Intergenic
1012694527 6:102361835-102361857 ATAAAGTTAGAGAAATAGGCAGG + Intergenic
1012793045 6:103724698-103724720 ATGGAAATGGAGAATTAGTCTGG - Intergenic
1013060077 6:106625195-106625217 ATGACACTGGAGAGGTAGGCAGG - Intronic
1013164782 6:107579936-107579958 AGGAGGATGGAGAATTAGGAGGG + Intronic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015333223 6:132005589-132005611 AAGAAGGTGGAGGAGCAGGCAGG + Intergenic
1015609801 6:135004530-135004552 ATGAAGCTGGAGAGATGGGCAGG + Intronic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1015986432 6:138888608-138888630 ATTAAGAAAAAGAAGTAGGCTGG - Intronic
1016023400 6:139259356-139259378 ATGAAGTTGGAGAGGTAAGCAGG - Intronic
1016156508 6:140816401-140816423 ATAAAAATTGATAAGTAGGCAGG + Intergenic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016624908 6:146155741-146155763 ATGAAGTTGGAGAAATTGGAAGG - Intronic
1016978317 6:149830761-149830783 AGGAAGATGGTGATGTAGGGAGG + Intronic
1017812818 6:157996455-157996477 ATGAGGGTGGAGAAAGAGGCAGG - Intronic
1018892011 6:167989371-167989393 ATGATGCTGGAAAAGTCGGCGGG - Intergenic
1019089611 6:169517420-169517442 ATGATGATGTGGAAGCAGGCTGG - Intronic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1020657382 7:10943649-10943671 ATTAAGAATGAGAAATAGGCTGG + Intergenic
1021161670 7:17280859-17280881 ATGAAAATGAAAAAATAGGCTGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1023422992 7:40003735-40003757 ATGGGATTGGAGAAGTAGGCAGG - Intronic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1026062559 7:67039158-67039180 ATTAAGAATGACAAGTAGGCCGG + Intronic
1026648921 7:72197693-72197715 ATAAAGATGGAAAATTAGCCAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028923891 7:96336756-96336778 ATGAAGATGAAGTAGTAGACAGG - Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029574966 7:101397364-101397386 AAGAAGATGAAGAAGAAGGAAGG - Intronic
1030270519 7:107663977-107663999 ATGAAAATAGAGAAGCTGGCTGG - Intronic
1030328490 7:108247740-108247762 ACGGAGATGGGGAAGTAGGAGGG - Intronic
1030510679 7:110479202-110479224 ATGAGGTTGGAGAAGTAGGCAGG - Intergenic
1030511101 7:110482791-110482813 ATGAGGTTGGAGAAGAAGGCAGG - Intergenic
1030828280 7:114188282-114188304 ATGAAGAAGAAAAACTAGGCAGG - Intronic
1031375037 7:121014254-121014276 ATAAAGATGTAGAATTGGGCCGG + Intronic
1031948600 7:127867843-127867865 ATAAACATGGAGAGGTAGGGAGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032355764 7:131209183-131209205 ATGAAGTTGGACAAGTGGACAGG + Intronic
1032612375 7:133429107-133429129 ATGATGAAGGAGAAGTAGTGAGG + Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034634198 7:152554271-152554293 ATGAAGGAAGAGAGGTAGGCAGG + Intergenic
1034655004 7:152722280-152722302 GTGAGGCTGGAGATGTAGGCAGG + Intergenic
1035004220 7:155643699-155643721 ATGAAACTGGAAAGGTAGGCAGG - Intronic
1035043558 7:155948670-155948692 GTCAAGAGGGAGGAGTAGGCTGG + Intergenic
1036637061 8:10558433-10558455 ATGAAGATGGAGATGCAACCAGG - Intergenic
1037296753 8:17409955-17409977 ACGAGGCTGGAGAAGTAGGAAGG + Intronic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1037677018 8:21059649-21059671 ATCAAGAGGGAGAAGTTGGAAGG - Intergenic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1038093108 8:24276569-24276591 GTGAATATGGAGAAGTAGCTTGG - Intergenic
1038152014 8:24950453-24950475 ATGAGGTTAGAGAACTAGGCAGG + Intergenic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1038906534 8:31910309-31910331 ATGAAAATGGAGACAGAGGCGGG + Intronic
1039012741 8:33112698-33112720 TTAAAGTTGGAGAGGTAGGCTGG + Intergenic
1039343139 8:36672983-36673005 ATGAGGATGGAAAAGAGGGCTGG - Intergenic
1040700926 8:50064625-50064647 ATGAGGTTGGAGGTGTAGGCAGG - Intronic
1041413768 8:57585133-57585155 ATTAAGATGTTCAAGTAGGCTGG + Intergenic
1041469139 8:58189623-58189645 ATGATGATGGAGACTTAGGCTGG + Intronic
1041504332 8:58578053-58578075 ATGAGGCTGGAGAATTAGCCTGG - Exonic
1041720526 8:60971373-60971395 ATTAAAAAGGAAAAGTAGGCCGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041853170 8:62417099-62417121 AGGAGGATGGAGATGTAGGTGGG - Intronic
1042544987 8:69943373-69943395 ATGAGGCTGGAGAATTAGCCTGG - Intergenic
1042813957 8:72857483-72857505 GTGAGGCTGGAGAAGTAGGTTGG + Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043135443 8:76518201-76518223 ATGAAGCAGGAAAAGTAGGTTGG + Intergenic
1043156941 8:76794843-76794865 ATAGAGATGGAGAAGGCGGCTGG + Intronic
1044204410 8:89475700-89475722 ATGAAGCTGGAAAGGTTGGCAGG - Intergenic
1044260393 8:90113028-90113050 ATGAGGTTGGAGAGGTAGGCAGG + Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044713971 8:95083207-95083229 ATGAAGCTGGGAAAATAGGCTGG - Intronic
1045002466 8:97890168-97890190 ATGAAAATGGTGGAGTGGGCCGG + Intronic
1045051864 8:98334755-98334777 ATGAGGCTGGAGAGGTAAGCTGG - Intergenic
1045115140 8:98973486-98973508 TGGAAGGTGGAGAACTAGGCCGG + Intergenic
1045233721 8:100330822-100330844 ATGAAGTTGGAGAGGTGGGCAGG - Intronic
1045258294 8:100548260-100548282 ATGAATTTGGAGAGGTAGGCAGG - Intronic
1045777760 8:105825811-105825833 AGCAAGGTGGAGAGGTAGGCAGG - Intergenic
1045834213 8:106501362-106501384 ATGAAGCCAGTGAAGTAGGCAGG + Intronic
1045995237 8:108354218-108354240 ATGGAGATAGAGTAGAAGGCTGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046034733 8:108827008-108827030 ATGAAGAGAGAGAAGTAGACAGG + Intergenic
1046159806 8:110346327-110346349 ATGAAGCTGGAGAAGATGGTAGG + Intergenic
1046812145 8:118544694-118544716 ATGAAGGTTGAGAAGGAAGCAGG - Intronic
1046814232 8:118566327-118566349 ATAAAGATGGAGTAGAAGACAGG - Intronic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048590795 8:135818810-135818832 AGGAAGAAGGAGCAGTAGGTGGG - Intergenic
1048919828 8:139218153-139218175 ATGAAGCTGGAGAAGTGGTTTGG - Intergenic
1048919939 8:139219052-139219074 ATGAAGCTGGAGAAGTGGTTTGG - Intergenic
1049034305 8:140062390-140062412 GTGAAGCTGGAAAAGCAGGCAGG - Intronic
1049838354 8:144754656-144754678 ATGAAGATGAAGAGGTGGGCAGG + Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050169589 9:2801496-2801518 ATGAAGATTGAGAATAAGGATGG + Intronic
1050225161 9:3445741-3445763 ATTATGCTGGAAAAGTAGGCGGG - Intronic
1050271480 9:3950430-3950452 ATGAGGCTGGAGAAGTAGGCGGG - Intronic
1050353456 9:4761756-4761778 CTAAAGATGGAGAAGCAGACTGG - Intergenic
1050465367 9:5917409-5917431 ATGAAGCTGGAGAGGTAGGCAGG + Intronic
1050649358 9:7758379-7758401 ATAAAGCTGGAGAAGCAGACAGG - Intergenic
1050667830 9:7961245-7961267 GTGGAGATTGTGAAGTAGGCGGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051784993 9:20732494-20732516 ATGAAGCTGGAAAGGTAGGTGGG + Intronic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1052394920 9:27927408-27927430 ATGAAGGTAGAGATATAGGCAGG + Intergenic
1052716140 9:32119825-32119847 ATGAGGCTGGGGAAGTTGGCAGG + Intergenic
1052830648 9:33212470-33212492 ATAAAGATGAAGACATAGGCAGG - Intergenic
1053421466 9:37982494-37982516 AAAAAAATGGATAAGTAGGCCGG + Intronic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1056590653 9:87963695-87963717 ATGAGGCTGCAGGAGTAGGCAGG - Intergenic
1057265442 9:93614331-93614353 ATGAAGCTGGGCCAGTAGGCAGG - Intronic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1057834151 9:98430658-98430680 ATGGAGAGGGAGAACTATGCAGG - Intronic
1058385532 9:104430877-104430899 GTGAGGATGGAGAATTGGGCAGG + Intergenic
1058713179 9:107698636-107698658 AGGAAGATGGAGGAGCAGGGAGG + Intergenic
1058814851 9:108673707-108673729 ATGAGGCTGGAGAAGGAAGCTGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059212542 9:112527446-112527468 ATGAAGTTGAAGAAGAAAGCAGG + Intronic
1059352561 9:113676042-113676064 TTAAAGGTGGAGAAATAGGCTGG + Intergenic
1059479304 9:114576033-114576055 GTGAGGCCGGAGAAGTAGGCAGG - Intergenic
1059794215 9:117673834-117673856 GTGAGGATGGTGAAATAGGCTGG - Intergenic
1059841056 9:118217064-118217086 ATGAAGATGGTTAGGTAGGCAGG - Intergenic
1060002776 9:119973595-119973617 ATGAGGCTGGAGCAGTAGGCAGG - Intergenic
1060125476 9:121040347-121040369 ATGAAGCTGGGGAAGAAGGCAGG + Intronic
1060387202 9:123241916-123241938 ATGAGGTTGGTGAGGTAGGCAGG - Intronic
1060647883 9:125297628-125297650 AGGAAATTGGAGAAGTAGCCAGG + Intronic
1060840351 9:126788599-126788621 ATGAGGCTGGAGGGGTAGGCAGG - Intergenic
1061025925 9:128049461-128049483 AAGAAAGTGGAGAAGTTGGCCGG + Intergenic
1061236118 9:129343574-129343596 AGGAGGATGGAGATGTGGGCAGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061752562 9:132790544-132790566 ATGAAGTTAAAGAAGTTGGCCGG - Intronic
1203753005 Un_GL000218v1:97438-97460 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1203538797 Un_KI270743v1:68202-68224 ATGAAAATGGCGGAGTGGGCCGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1186215893 X:7300860-7300882 ATTAAGATGGGGAAGGATGCAGG + Intronic
1186984188 X:14993734-14993756 ATGATGATGTAGAAGCAAGCTGG - Intergenic
1187357579 X:18591621-18591643 ATGAAGCTGGAGAACTAAGAAGG - Intronic
1187998334 X:24953644-24953666 ATCAAGTTGGACAAATAGGCAGG + Intronic
1188165243 X:26854547-26854569 ATGACGATAGAGAGGTAAGCGGG - Intergenic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189424940 X:40891093-40891115 ATGAGGCTGGAGAATTAGCCTGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189900366 X:45700202-45700224 ATAAGGCTGAAGAAGTAGGCAGG + Intergenic
1190384644 X:49873054-49873076 ATGAAGATAGAGGTGCAGGCAGG - Intergenic
1190816270 X:53932608-53932630 ATGAAGCTGAAGAGGTTGGCAGG - Intergenic
1192244350 X:69360450-69360472 ATGAAACTGGAGAGGTAGGCTGG + Intergenic
1192553573 X:72072452-72072474 GTGAGGCTGGAGAAGTAGGAGGG - Intergenic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1194247668 X:91536033-91536055 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1194673540 X:96765764-96765786 ATGAAACTAGAGAAGCAGGCAGG - Intronic
1194710961 X:97235721-97235743 ATGAAGTTTGAGAGGTAGGTAGG - Intronic
1195113456 X:101670264-101670286 GTGAAGATAGAGAAGTAAGCAGG - Intergenic
1195116739 X:101706955-101706977 TTGAAGATAGAGTAGTAGCCAGG + Intergenic
1195485483 X:105400056-105400078 ATGAAGCTGGAGAAGTAAGCAGG + Intronic
1195502962 X:105624194-105624216 ATGAAGTTGGAAGATTAGGCTGG + Intronic
1195513315 X:105742886-105742908 ATGGAGATGGAGAAGGGGACTGG - Intronic
1196050094 X:111295859-111295881 ATGAAAATGGAGAAGAAGAAAGG + Exonic
1196601535 X:117606447-117606469 ATGAAGATAGAGTAGAAGGATGG + Intergenic
1196696108 X:118613891-118613913 ATGAAGCTGGACAAGTAAGTTGG + Intronic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197168478 X:123405536-123405558 ATGAAGCTAGAGAGGTAGGCGGG - Intronic
1197457107 X:126690613-126690635 ATGAGGATAGAGAGGTAGCCAGG - Intergenic
1197635571 X:128911228-128911250 GTAAAGCTGGAAAAGTAGGCAGG + Intergenic
1197823131 X:130561643-130561665 ATGAAGCTGGAGAATTAGGCGGG + Intergenic
1197823573 X:130565558-130565580 ATGAAGATAGAGAAGCAGGGAGG + Intergenic
1197839861 X:130734712-130734734 ATCCAGATGGAAAAGAAGGCTGG - Intronic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198374909 X:136029245-136029267 ATGAGGATGGAAAAGTAGGTTGG + Intronic
1198511730 X:137358823-137358845 ATGAAGATGGAGAAGTAGCCAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199202396 X:145107776-145107798 ATGAGGATGGAAAGGTAAGCTGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199569895 X:149256729-149256751 ATGAGACTGGAGAAATAGGCAGG + Intergenic
1199702901 X:150398187-150398209 ATGAAGTGGTAGATGTAGGCTGG - Intronic
1200138916 X:153887717-153887739 ATCAGGATGGTGAAGTAAGCAGG + Intronic
1200566688 Y:4777563-4777585 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1201166647 Y:11215008-11215030 AGGAAAATGGCGAAGTGGGCGGG + Intergenic