ID: 987206854

View in Genome Browser
Species Human (GRCh38)
Location 5:15636269-15636291
Sequence CTGTAGATGAGGAGAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987206854_987206857 12 Left 987206854 5:15636269-15636291 CCCTCAACTCTCCTCATCTACAG 0: 1
1: 0
2: 0
3: 15
4: 233
Right 987206857 5:15636304-15636326 AGTTTTTCAGACTGAATTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987206854 Original CRISPR CTGTAGATGAGGAGAGTTGA GGG (reversed) Intronic
900780679 1:4615549-4615571 CTGCACATGGGGAGAGATGAGGG - Intergenic
901835243 1:11919861-11919883 CTGTAGATGGTGAGTGTTGGCGG - Exonic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902165080 1:14563652-14563674 ATGGAGCTGATGAGAGTTGAGGG - Intergenic
902740629 1:18435746-18435768 CTGCAGAGGAGGAGGGTTTATGG - Intergenic
906464157 1:46061168-46061190 AAGTACATGAGGAGAGTTTAGGG - Intronic
906773107 1:48502768-48502790 CTGAGGATGAGTAGAGTGGATGG + Intergenic
907946182 1:59138657-59138679 CTGTGGATGTGCAGAGTTGGAGG + Intergenic
908787993 1:67754127-67754149 TTGGAGGTGAGGAGAGATGAAGG - Intronic
910061677 1:83101033-83101055 CTGAATATTAGGAAAGTTGAAGG + Intergenic
915831885 1:159139101-159139123 CTCAGGATGAAGAGAGTTGAAGG + Intronic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
920729820 1:208472989-208473011 CTGCAGATGTGGAGAAGTGAAGG - Intergenic
922188576 1:223297419-223297441 CTGTGGATGAGGACAAGTGACGG + Intronic
922295004 1:224242210-224242232 CTGGAGATGAGTAGTGGTGATGG + Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922479340 1:225928205-225928227 CTGAAGTTGAGGAGAGGAGAGGG + Intergenic
923044474 1:230345434-230345456 CTGCAGATGAGGGGAGAGGAGGG + Intronic
923429693 1:233908152-233908174 CTATAAATGGGGAGAGATGATGG + Intronic
1063060076 10:2541984-2542006 CTGGAGATGTGGAGAGTTTAGGG + Intergenic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1066062862 10:31739552-31739574 CTGTACATCAGAAGAGTTGCAGG + Intergenic
1066392864 10:34992887-34992909 CTGAAGAAGAGGATAGTTGCAGG - Intergenic
1067678441 10:48408534-48408556 CAGGAGATGAAGTGAGTTGATGG + Intronic
1067689277 10:48491007-48491029 CTCTAGATGAGGAGTGGTGGTGG - Intronic
1068091812 10:52441197-52441219 CTGAAGTTGAGGGGAGTGGATGG - Intergenic
1069886389 10:71626578-71626600 CAGCAGGTGGGGAGAGTTGAGGG - Intronic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073137154 10:101226374-101226396 CTGTGGAGGAGGTGAGGTGAGGG + Exonic
1074948599 10:118305423-118305445 CTGGAGATGAGGAGCATTGGTGG - Exonic
1078724838 11:13920732-13920754 CTACGGATGGGGAGAGTTGAGGG + Intergenic
1079784678 11:24656819-24656841 CTCCAGCTGAGGAGAGATGAGGG - Intronic
1080180970 11:29425876-29425898 CTATAGATGAGCAAAGGTGAAGG - Intergenic
1081328819 11:41779099-41779121 CTTTTGAAGAGGAGAGATGAAGG - Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089402614 11:118173083-118173105 CTGGAGGTGAGGAGTGATGAGGG - Intronic
1089771795 11:120808509-120808531 CTGTTGGTGAGGAGAGGCGATGG + Intronic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091922379 12:4315759-4315781 CAGGAGATGAGAATAGTTGAGGG - Intergenic
1092672913 12:10883431-10883453 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1092672971 12:10884076-10884098 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1093670417 12:21867781-21867803 CTGAAGAGGAGGATGGTTGATGG + Intronic
1095535758 12:43245023-43245045 CTGAAGATGTGGGGAGATGATGG + Intergenic
1097504052 12:60441965-60441987 ATGTTGAAGAGGAGAGGTGAGGG - Intergenic
1098601931 12:72341681-72341703 ATGTAGATGAGAAGTGGTGATGG + Intronic
1098645697 12:72898041-72898063 CTGTAGACGAGGAGAGGAGGTGG + Intergenic
1099529309 12:83756857-83756879 GTGTAGATGACTGGAGTTGAGGG + Intergenic
1100839115 12:98594016-98594038 CTGCAGATGTGGCGTGTTGAAGG - Exonic
1101203007 12:102456453-102456475 CTGTAGTTGAGCAGAAATGAGGG - Intronic
1104988680 12:132611992-132612014 GTGAAGAGGAGAAGAGTTGATGG - Intergenic
1105048093 12:133023655-133023677 CTGTAGAAGAGGAGATGAGATGG - Exonic
1106363179 13:29051084-29051106 CTGTAGAATAGGAGAGGTAATGG + Intronic
1106668701 13:31881400-31881422 CTGTGGATGAGTAGTGGTGATGG + Intergenic
1110973617 13:81800698-81800720 GTGTAGATGATCACAGTTGAAGG + Intergenic
1113008031 13:105730036-105730058 CTGTTGATGCTGAGATTTGAAGG + Intergenic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1115053844 14:29098118-29098140 ATGTATATGCTGAGAGTTGATGG - Intergenic
1118513822 14:66505857-66505879 ATGGAGATGGGGAGGGTTGATGG - Intergenic
1118948848 14:70415671-70415693 CTGCAGATGAGAAAAGGTGATGG + Intronic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1120033034 14:79664232-79664254 CTGTAGATGAGGAGCAGTGAAGG + Intronic
1122411426 14:101527964-101527986 CTGGGGAGGCGGAGAGTTGAGGG + Intergenic
1122704189 14:103609751-103609773 CTGGAAATGAGGAGAGGGGAGGG + Intronic
1124102081 15:26704874-26704896 CAGAAGAAGAGGAGAGGTGAAGG - Intronic
1125039134 15:35162889-35162911 CTTTAAATGAGGAGAAGTGAGGG + Intergenic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128732726 15:70032050-70032072 ATCTAGATGTGGAGAGGTGAAGG + Intergenic
1128889119 15:71315188-71315210 CCAGAGATGAGGAGAGATGAAGG - Intronic
1129995354 15:79999991-80000013 ATGAAGATGAACAGAGTTGAAGG + Intergenic
1130536632 15:84790108-84790130 CTGCAGGTTAGGAGAGTTGCGGG - Intronic
1131956706 15:97743572-97743594 CTGCAGATGATGAGAATTCAGGG + Intergenic
1136670777 16:31855058-31855080 GTGTGGATGAGGAGAGTAGTGGG - Intergenic
1137725236 16:50652395-50652417 CATTAGATGAGCTGAGTTGAAGG + Intergenic
1141708375 16:85682741-85682763 CTGTAGAGGGGGAGGGCTGAGGG - Intronic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1146267254 17:31461014-31461036 CTGTGGATGGTGAGAGTTGGTGG - Intronic
1146807160 17:35873848-35873870 CTGTGGCTCAGGGGAGTTGAGGG + Intronic
1147978380 17:44260584-44260606 CTGCAGATGAGGATTGTTGTGGG - Intronic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1149378865 17:56072805-56072827 GTGCAGATGAGGAGAGGAGAAGG + Intergenic
1155315426 18:24566467-24566489 CTGTAGACGAGGAGAGAGAAAGG + Intergenic
1157630754 18:49092960-49092982 CAGTGAATAAGGAGAGTTGAAGG + Intronic
1158150389 18:54361368-54361390 GTCTAGATGATGAAAGTTGAAGG + Intronic
1159243786 18:65778443-65778465 TTGCAGAAGAGGAGAATTGAAGG - Intronic
1160395753 18:78571495-78571517 GTATTGATGATGAGAGTTGACGG + Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160932638 19:1577938-1577960 CTGTAGAGGACGAGCGTGGAGGG + Exonic
1162362574 19:10228864-10228886 CTGGAGATTAGGAGAGGGGAAGG + Intronic
1164802962 19:31092892-31092914 CTGAGGATGAGGAGATTTGATGG - Intergenic
1165347795 19:35259676-35259698 CAGTGAATGAGGACAGTTGATGG + Intronic
1165986855 19:39777035-39777057 CTGTAGTTGAGGTGTGTTGTGGG - Intronic
1167654199 19:50752828-50752850 TTGGGGATTAGGAGAGTTGAAGG + Intergenic
926222480 2:10945259-10945281 ATGTAGATGAAGGGGGTTGATGG - Intergenic
928359912 2:30654731-30654753 CTGAAGAGGAGGAGAGGGGAGGG - Intergenic
929403266 2:41610596-41610618 CTGTAGAAAAGGAGACGTGATGG + Intergenic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930640550 2:53850349-53850371 CTGTATTTGGGGAGAGCTGAGGG + Intergenic
930752909 2:54949446-54949468 CTGTGGCTGAGGGGAGTTGAGGG + Intronic
932378640 2:71261367-71261389 CTTTAGAGGGGGAGGGTTGAAGG + Intergenic
935042514 2:99446845-99446867 GTGGACAGGAGGAGAGTTGAGGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
937363501 2:121244813-121244835 CTGTACATGAGGGGAGGTGGTGG + Intronic
937542305 2:122972124-122972146 TTTTAGATGGTGAGAGTTGATGG - Intergenic
937712750 2:124996700-124996722 CTGTAGATAATGAGAGTTCAGGG + Intergenic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938772006 2:134508744-134508766 CTGGAGTTCAGGAGAGTTGAGGG - Intronic
938922052 2:136004028-136004050 CTGGAGTTGAGTAGAGATGAAGG - Intergenic
939620886 2:144417671-144417693 CAGAAGATGAGGAGAGTAGGGGG + Intronic
942378409 2:175361092-175361114 CTGTAGATGAGGTCAATGGAAGG - Intergenic
943792384 2:191948042-191948064 TTGGAGATGAAGAGAGTTGCAGG + Intergenic
946192241 2:218013703-218013725 CTGTGGCTGAGGAGAGGTGCGGG - Intergenic
947425647 2:229980761-229980783 CTGGACAGCAGGAGAGTTGAGGG + Intronic
1169735812 20:8836386-8836408 CTGAGAATGAGGAGAGCTGATGG + Intronic
1171239270 20:23551840-23551862 CTGGAGATGCAGAGAGTTGGGGG + Intergenic
1172288000 20:33754703-33754725 ATGTAGATGAGGGTATTTGAGGG + Intronic
1172955166 20:38751687-38751709 CAGTAGATGTGGAGTGTTAAGGG + Intronic
1173728447 20:45312567-45312589 CTGGGGATGAGAAGAGTTGGAGG + Intronic
1174311933 20:49663197-49663219 CTGGAGTGCAGGAGAGTTGAAGG + Intronic
1175069481 20:56320674-56320696 TTGTATATGATGAGAGATGAGGG - Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1178431202 21:32520239-32520261 CTGTAGAAGAGGACAGGTGTGGG - Intergenic
1181735295 22:24876732-24876754 CTGCAGATGGAGAGAGCTGAAGG + Intronic
1182575740 22:31271788-31271810 CAGTAGATGGGGAGACTTGGGGG - Intronic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
952284401 3:31954282-31954304 TTGTAGAGGATTAGAGTTGAGGG - Intronic
954004528 3:47580201-47580223 CTGTAGATAAGATGAGATGATGG - Exonic
957481424 3:80802004-80802026 CTTTAGATAAGGAGAATTGCAGG - Intergenic
958110428 3:89135404-89135426 CTGTAAATGCTGAGAGTTAAGGG - Intronic
958798882 3:98733452-98733474 CTGTACGCGAGGAGGGTTGAGGG + Intronic
960259842 3:115554367-115554389 CTTTAGATAGGGAGACTTGATGG + Intergenic
960284258 3:115809660-115809682 GTGGAGGTGAGGAGAGGTGAGGG + Exonic
960745938 3:120888687-120888709 CTGTTGCTGAGGATAGATGAGGG + Intergenic
961333026 3:126154144-126154166 CTGAAGATGGGGAGACTTGGGGG - Intronic
965604917 3:170488665-170488687 TTGTAGATGATGAGAGATAAAGG - Intronic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966469994 3:180278421-180278443 GAGAAGATGAGGAGAGGTGAAGG - Intergenic
970660496 4:18279959-18279981 CTGTTGGTGAGGAAACTTGATGG + Intergenic
971392679 4:26200733-26200755 CTGAAGTTGAGGAGATTTGTGGG - Intronic
971528614 4:27655828-27655850 CTATAGATGAGGACAATTAAAGG + Intergenic
972368938 4:38403380-38403402 CTGGAGACCAGGACAGTTGATGG + Intergenic
973264186 4:48194630-48194652 GAGTAGATGATGAGAGTTGGGGG + Intronic
974499690 4:62684149-62684171 CTGTAGCTGGGGAGACTGGATGG + Intergenic
974914194 4:68159577-68159599 CACTAGCAGAGGAGAGTTGAAGG + Intergenic
975671902 4:76788251-76788273 AAGTAGATGAGGGGAGTTAAAGG - Intergenic
976227921 4:82811161-82811183 CTGGAGATGACCAGATTTGAAGG + Intergenic
977689961 4:99894781-99894803 TTGTAGATGAAGAAATTTGAGGG + Intergenic
979894592 4:126144165-126144187 CTGGACATGAGGACAGATGAAGG + Intergenic
981660971 4:147166250-147166272 CTATAGATAAGGAGATTTGAAGG - Intergenic
983631229 4:169851706-169851728 CTTAAGATGAGGGGAGCTGAGGG + Intergenic
983851059 4:172581506-172581528 ATGTAGAAGAGAAGAGCTGATGG - Intronic
985344823 4:188993054-188993076 CTGTGGATGACAAGAGTTAATGG - Intergenic
985384085 4:189426809-189426831 CTGAAGATAAGGAAAGTTGAAGG + Intergenic
986275898 5:6274799-6274821 CTGTAGAAGAGAACAATTGATGG + Intergenic
987206854 5:15636269-15636291 CTGTAGATGAGGAGAGTTGAGGG - Intronic
990092454 5:52070124-52070146 CAGAAGTTGAGGAGAGTAGAAGG + Intronic
990377371 5:55185197-55185219 TTGCAGATGAGGAGAGATGGAGG - Intergenic
990568623 5:57055312-57055334 CTGTAGAGTAGGGGAGTTAAGGG - Intergenic
991770003 5:70031453-70031475 CTGGAGATGAGAAGGGTTAAGGG + Intronic
991849298 5:70906872-70906894 CTGGAGATGAGAAGGGTTAAGGG + Intronic
994459218 5:100052017-100052039 ATGAAGATGATGAGCGTTGAGGG + Intergenic
994899626 5:105754321-105754343 CTGGAGAGGAGGAGGGTTGCTGG - Intergenic
996507938 5:124288663-124288685 CTGTATATAAGGCCAGTTGAAGG - Intergenic
996856511 5:128014250-128014272 CTCTAGAACAAGAGAGTTGAAGG - Intergenic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
997807046 5:136928354-136928376 ATGTAGATGATGTAAGTTGATGG - Intergenic
998138333 5:139686072-139686094 CTGTAGCAGAGGAGAGGTGAGGG - Intergenic
998741026 5:145201967-145201989 GTGTAGAAGAGGAGGGGTGATGG - Intergenic
1000403315 5:160856690-160856712 ATGTAGATGATTTGAGTTGAGGG + Intergenic
1000953779 5:167517837-167517859 CTGGTGATGAGGGGGGTTGATGG + Intronic
1001314269 5:170631692-170631714 CTGGAGGGGAGGAGATTTGAGGG - Intronic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003327892 6:5106505-5106527 CTGTGGATGAAGGGAGTTAAAGG + Intronic
1003670266 6:8150870-8150892 CTGGAGACCAGGAGAGCTGATGG + Intergenic
1005173010 6:23009821-23009843 CTGGAGACCAGGAGAGCTGATGG - Intergenic
1006270998 6:32967740-32967762 CTGTCGGTGAGGAGAGATTAGGG + Intronic
1006990243 6:38209145-38209167 CTGGAGATGAGGAGAGCTTTTGG + Intronic
1007616954 6:43185874-43185896 CTGTAGAGGAGGATACTTCAGGG + Intronic
1007979654 6:46138572-46138594 CTGGAGGTGAAGAGAGTTGCCGG - Intronic
1008349319 6:50471309-50471331 ATGAAGAAGAGGAGAGGTGATGG - Intergenic
1012538372 6:100327676-100327698 ATGCAAATGAGGAGAGGTGAAGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1015230647 6:130911414-130911436 ATGTAGATGACGGGGGTTGATGG + Intronic
1019625486 7:2013786-2013808 GTGTAGATGAGAAGTGTGGATGG + Intronic
1019875642 7:3808240-3808262 TTGTAGAGAAGAAGAGTTGACGG + Intronic
1020714807 7:11658674-11658696 CTGTAGATAAGCAGAGTTTCAGG + Intronic
1022391522 7:29948272-29948294 CTGGAGCTTAGGAGGGTTGAAGG - Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024098185 7:46003029-46003051 CTCTAGATGTGGGGAGTTAAGGG + Intergenic
1028341948 7:89733050-89733072 ATGAGAATGAGGAGAGTTGATGG + Intergenic
1028366298 7:90036593-90036615 ATGTAGATGACGAGGGTTGATGG + Intergenic
1028505588 7:91567119-91567141 CTGTATATGGGGATAGTTGGTGG - Intergenic
1028973790 7:96889741-96889763 CTGTAGATCAACAGACTTGAAGG + Intergenic
1029093797 7:98069329-98069351 AAGGAGATGAGGAGAGTTCATGG + Intergenic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1031923159 7:127615741-127615763 CCTTAGATCAGGAGAGTTGGCGG - Intronic
1032345331 7:131110846-131110868 CTGAAGATGAGGAGAGAAGCGGG - Intronic
1033724600 7:144101043-144101065 CTGTAGATGAACAGGCTTGAAGG - Intergenic
1034926265 7:155124889-155124911 CTGGTGATGAGGAGAGTGGGCGG + Intergenic
1036576912 8:10036237-10036259 CTGTGGAAGAGGAGAGCTGTAGG - Intergenic
1036699946 8:11006547-11006569 CTGTAGATGAACAGGGTTGTGGG + Intronic
1037219837 8:16504981-16505003 ATGTAGAAGAGGAAAGTTGGTGG + Intronic
1038161897 8:25047396-25047418 CTCTAGAGGAGAACAGTTGAAGG + Intergenic
1050181469 9:2927420-2927442 ATGTAGATGATGGGGGTTGATGG + Intergenic
1050296013 9:4206040-4206062 ATCTAGAAGAGAAGAGTTGAAGG + Intronic
1050308609 9:4330594-4330616 ATGGAGATGAGGAGAGGTGGAGG + Intronic
1050308616 9:4330627-4330649 ATGGAGATGAGGAGAGGTGGAGG + Intronic
1050760162 9:9058958-9058980 CTGAAGAAGAGGAGATTTGAAGG + Intronic
1051847117 9:21464461-21464483 CTGCAAATGAGAAGAGATGAGGG - Intergenic
1052030901 9:23627680-23627702 TTATAGATGAGGAGTGTTGGAGG - Intergenic
1052334844 9:27308752-27308774 CCTTAGATGAGGAGATGTGATGG - Intergenic
1055865850 9:80812263-80812285 CTGAAGAGAAGAAGAGTTGAAGG + Intergenic
1057051721 9:91928851-91928873 ATGTAGATGAGGAAAGTGCAGGG - Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1062412183 9:136431180-136431202 TGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412203 9:136431234-136431256 CGGGAGATGAGGAAAGGTGAGGG - Intronic
1062412219 9:136431276-136431298 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412234 9:136431317-136431339 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412249 9:136431358-136431380 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412265 9:136431400-136431422 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412281 9:136431442-136431464 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412312 9:136431525-136431547 CGGGAGATGAGGAAAGGTGAGGG - Intronic
1062412344 9:136431609-136431631 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412360 9:136431651-136431673 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412390 9:136431733-136431755 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1062412406 9:136431775-136431797 AGGGAGATGAGGAGAGGTGAGGG - Intronic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1192305286 X:69952737-69952759 CCCCAGAAGAGGAGAGTTGAGGG - Intronic
1196746131 X:119073127-119073149 CTGTGGCTGAGGGGAGGTGAGGG - Intergenic
1197675464 X:129325262-129325284 CTATAGATGAGGGAAGTTCAAGG + Intergenic
1197849521 X:130842860-130842882 CTGTACATCATGAGAGTTCATGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198649164 X:138842061-138842083 CTGATGATGAGCAGAGGTGAAGG - Intronic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1199493059 X:148422625-148422647 CTCTAGAGTAGGAGAGTTGAGGG - Intergenic
1199531009 X:148847599-148847621 CTCTAGATCCAGAGAGTTGATGG + Intronic
1200316991 X:155144774-155144796 ATGTAGATGATGGGGGTTGATGG + Intronic
1201708377 Y:16961858-16961880 ATGTAGATGATGAGGGTTGATGG + Intergenic
1201862215 Y:18611379-18611401 ATGGAAATGAGGAGAGTTCAAGG - Intergenic
1201863105 Y:18621202-18621224 ATGGAAATGAGGAGAGTTCAAGG - Intergenic
1201870218 Y:18699176-18699198 ATGGAAATGAGGAGAGTTCAAGG + Intergenic
1201871108 Y:18709001-18709023 ATGGAAATGAGGAGAGTTCAAGG + Intergenic