ID: 987211430

View in Genome Browser
Species Human (GRCh38)
Location 5:15687594-15687616
Sequence CTGGTGTAGCACTGCCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987211429_987211430 -10 Left 987211429 5:15687581-15687603 CCATTGTTCTCAACTGGTGTAGC 0: 1
1: 0
2: 2
3: 14
4: 98
Right 987211430 5:15687594-15687616 CTGGTGTAGCACTGCCCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 133
987211427_987211430 21 Left 987211427 5:15687550-15687572 CCTTTTGCATTAGTTATAATAAC 0: 1
1: 0
2: 0
3: 26
4: 304
Right 987211430 5:15687594-15687616 CTGGTGTAGCACTGCCCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987211430 Original CRISPR CTGGTGTAGCACTGCCCTCA AGG Intronic
900954588 1:5878677-5878699 CTGGAGGATCACTGACCTCAGGG + Intronic
901810799 1:11765962-11765984 CTGGTCTAGCACTGCCCCTGGGG - Exonic
903811953 1:26039492-26039514 CTGGTAAAGCACTGGCCTTAAGG + Intronic
904425862 1:30422561-30422583 CTGGTCCTGCAGTGCCCTCAGGG + Intergenic
905914027 1:41672706-41672728 CTGCTCAAGCCCTGCCCTCAAGG - Intronic
906586572 1:46983981-46984003 CTGCTGTAGCTCTGCCAACAAGG - Intergenic
907490006 1:54802995-54803017 GTGGTATAGCAGTGCCCTCAGGG - Intergenic
909057040 1:70833711-70833733 CTGCTGGGGCACGGCCCTCATGG + Intergenic
916864943 1:168846424-168846446 CTGGTGCAGCAGTGGCGTCATGG - Intergenic
917381482 1:174413940-174413962 CTGGTCTATCCCTGCCTTCATGG - Intronic
920065935 1:203269757-203269779 CTGGTGTAGCACATGCTTCAGGG - Intronic
920736660 1:208539050-208539072 CTGGTGGGGCACTGTCCTGAGGG + Intergenic
1073611544 10:104948567-104948589 TTGATATAGCTCTGCCCTCATGG + Intronic
1077268944 11:1666169-1666191 CTGCTGTGGCTCTGCCCTCCTGG + Intergenic
1077271808 11:1685011-1685033 CTGCTGTGGCTCTGCCCTCCTGG - Intergenic
1081120037 11:39255262-39255284 CTGCAGTAGCAGTGCCCTCATGG - Intergenic
1081625735 11:44654099-44654121 CTGATGCAGGACTGCCCTCCTGG + Intergenic
1082694871 11:56350336-56350358 CAGGTGTAGACCTACCCTCATGG + Intergenic
1083484484 11:62974859-62974881 CTCAGGCAGCACTGCCCTCATGG - Intronic
1084672445 11:70615283-70615305 CTGGTGTGGGACTGTCCTCTAGG + Intronic
1089858358 11:121567056-121567078 CTGATGTGTGACTGCCCTCAGGG + Exonic
1091923493 12:4324415-4324437 CTGGTGAAGCACTGCCGGCCCGG - Intronic
1092077535 12:5685949-5685971 CTGGAGCAGCACTCCCCTCAAGG + Intronic
1093012827 12:14126845-14126867 CTTGTGAAGCACTGTCCCCATGG + Intergenic
1093076170 12:14760989-14761011 CTGCAGCAGCACAGCCCTCATGG + Intergenic
1096625114 12:52890277-52890299 ATGGTGTGTCCCTGCCCTCATGG + Intergenic
1096744804 12:53719060-53719082 CTGGTCTTGAACTGACCTCAGGG + Intronic
1097695802 12:62773833-62773855 CTGCTGAAGCACAGCTCTCAGGG + Intronic
1099412777 12:82351520-82351542 CTGGTTTTGAACTGGCCTCAGGG - Intronic
1100593527 12:96051944-96051966 TCAGTGTAGCACTGCCCACATGG - Intergenic
1100645112 12:96520775-96520797 CTTGTGTAGGACTGCCTTCATGG + Intronic
1104915405 12:132261870-132261892 TGTGAGTAGCACTGCCCTCAGGG + Intronic
1106548015 13:30747095-30747117 CTGGCTCAGCTCTGCCCTCATGG - Intronic
1108437797 13:50417676-50417698 CTGTTCTAGCAGTGACCTCACGG + Intronic
1109725933 13:66341836-66341858 CTTGTGTCTCACTGCGCTCAAGG + Intronic
1111039303 13:82724154-82724176 CTGGTGTGGCACTTCTTTCAGGG + Intergenic
1115309657 14:31966385-31966407 CTTGATTAGCAGTGCCCTCATGG + Intergenic
1117091058 14:52250762-52250784 CTGATGTTGCTCTTCCCTCAAGG + Intergenic
1118249581 14:64146761-64146783 CTGCTTTAGCACTGCCCTTGTGG + Intronic
1122884548 14:104705113-104705135 CTGGTGTTGAAATGGCCTCAGGG + Intronic
1124076837 15:26454145-26454167 CTGGTCTTTCACTGCCCTCAAGG - Intergenic
1126229232 15:46306125-46306147 CTGGGGTAGCACTTCCCTCATGG - Intergenic
1126349168 15:47726881-47726903 CTGTTGTGGAACTGGCCTCAAGG - Intronic
1127384654 15:58457499-58457521 CTGCTGCAGCTCTGCCCTGAAGG - Intronic
1130060698 15:80567751-80567773 CTGGTGTAACTGTGCCCTGAGGG - Intronic
1135028182 16:19014700-19014722 CTTTTGTAGCACTTCCCCCAGGG + Intronic
1143386923 17:6536501-6536523 CTGGTTTAGGGCTGGCCTCAGGG + Intronic
1148073141 17:44920331-44920353 CTGCTATAGCACTGTCCTCAAGG + Intergenic
1148088861 17:45010599-45010621 CTGGGATAGCTCTGCCCTCCAGG + Intergenic
1155510018 18:26566955-26566977 CTTTTGTGGCACTACCCTCAAGG - Intronic
1157332747 18:46715309-46715331 CAGGGGTCGCACTGCCCCCAAGG + Intronic
1164087752 19:21919228-21919250 CTGCTTTGGCACTGCCCACAGGG + Intergenic
1164523335 19:28995491-28995513 CTGGTGGAGGGCAGCCCTCAGGG + Intergenic
925877016 2:8320149-8320171 CTGCTCTATCACTGCCTTCATGG - Intergenic
926329051 2:11809975-11809997 CTGGGTTAGCAGTGACCTCAGGG - Intronic
926765457 2:16319555-16319577 CAGCTGTGGCCCTGCCCTCAGGG - Intergenic
927912747 2:26912930-26912952 CTGGAGTAGCCCTGGCCTGACGG - Intronic
928264491 2:29800197-29800219 CAGGTGGGGCACAGCCCTCATGG + Intronic
928950153 2:36807031-36807053 CTGGGGTGACACTGCCCTCTGGG - Intronic
929028582 2:37629425-37629447 CTGGAGTAGCAGTGCCATCTGGG + Intergenic
929258155 2:39836783-39836805 CTCTTGTAGCACTGGTCTCATGG + Intergenic
935205687 2:100894848-100894870 CTGGTGAAGTACTGCTCTTATGG + Intronic
936348157 2:111690915-111690937 TTGGTGTAGCTCTGAGCTCAGGG + Intergenic
936417626 2:112331926-112331948 CTGGTTCATCACAGCCCTCAGGG + Exonic
936813590 2:116432835-116432857 CTTGGGCAGCTCTGCCCTCACGG + Intergenic
937015353 2:118600439-118600461 ACGGTGTAGCACTGGCATCATGG - Intergenic
945357875 2:208860467-208860489 CTGCAGTAGCAGAGCCCTCATGG + Intergenic
946986144 2:225275697-225275719 CTGATATTGCACTGCCCTCAAGG - Intergenic
947047506 2:226005112-226005134 CTTGTGTGGCCCTGCCCCCATGG + Intergenic
947838195 2:233189986-233190008 CTGACGTAGCATTGCCTTCAGGG + Intronic
948260616 2:236601959-236601981 CTGGTGGTTCCCTGCCCTCATGG - Intergenic
948260626 2:236601991-236602013 CTGGTGGTTCCCTGCCCTCATGG - Intergenic
948260637 2:236602024-236602046 CTGGTGGTTCCCTGCCCTCATGG - Intergenic
948260647 2:236602056-236602078 CTGGTGGTTCCCTGCCCTCATGG - Intergenic
1170032877 20:11960553-11960575 CTATTGTAGCAGTGACCTCAAGG - Intergenic
1170046997 20:12096011-12096033 TGAGTGTAGGACTGCCCTCATGG - Intergenic
1170333075 20:15236952-15236974 TGGGTGTAGCACTGCCCTCTAGG + Intronic
1171203405 20:23259777-23259799 CTGGTGCATCACTGCCATCCTGG - Intergenic
1171454111 20:25257298-25257320 CTGCTGAAGCACAGCCCCCAAGG - Intronic
1172301400 20:33852976-33852998 CTGGTCATGCACTGCCCCCAGGG - Intronic
1173121948 20:40301122-40301144 CAGGTGTAGTACTAACCTCAAGG + Intergenic
1174265007 20:49325016-49325038 CAGGTACAGCCCTGCCCTCAAGG - Intergenic
1174478496 20:50814332-50814354 GTGATGTACCACTGCCCTCCTGG - Intronic
1174670763 20:52305712-52305734 CAGGTGTAGCCCTGACCACATGG + Intergenic
1175272417 20:57743808-57743830 CTGCTCTAGCCCTGCCCTCATGG - Intergenic
1175301027 20:57942821-57942843 CTGGTGTAACACTTACCACAGGG - Intergenic
1175811400 20:61860351-61860373 GAGGTGTAGCTCAGCCCTCAGGG - Intronic
1176097810 20:63352330-63352352 CTGCTGGAGCTCTGCCCTCCAGG + Intronic
1176170135 20:63693030-63693052 CGGCGGCAGCACTGCCCTCAGGG - Intronic
1181051073 22:20238593-20238615 CTGGTGCAGCTCAGCCCCCAGGG + Intergenic
1184832266 22:46996311-46996333 CTGTGGCAGCTCTGCCCTCAGGG - Intronic
950502388 3:13372723-13372745 CTGGCGAAGCACTGGCCTGAAGG + Intronic
950871937 3:16237230-16237252 CTGGTATAGCCCTGGCCTCAAGG - Intergenic
951505895 3:23444638-23444660 GTGTTGGAGCACTGCCCTCCAGG - Intronic
952151389 3:30596357-30596379 GTGCTATAGCAATGCCCTCAGGG + Intergenic
953702357 3:45206655-45206677 CTTGTGGAGCTCTGTCCTCATGG - Intergenic
957998930 3:87727336-87727358 CTGTGGTAGCTCTGCTCTCATGG - Intergenic
960265062 3:115611782-115611804 CTGGTGTAGGAATGGCTTCAAGG + Intergenic
967411550 3:189171435-189171457 AAGATGTAGCATTGCCCTCAAGG + Intronic
969673821 4:8603988-8604010 CTGACGAGGCACTGCCCTCAGGG + Exonic
976172183 4:82315760-82315782 CTGGTCAAGAACTGACCTCAGGG + Intergenic
976913795 4:90343844-90343866 ATGGGGTAGCCATGCCCTCAAGG + Intronic
978921940 4:114194217-114194239 CTGGTTTATCACTGCCCTTTGGG + Intergenic
983250413 4:165339015-165339037 CCAGTGTAGCACTGTCCACAAGG - Intronic
987211430 5:15687594-15687616 CTGGTGTAGCACTGCCCTCAAGG + Intronic
990942877 5:61221017-61221039 CTGGCTTCTCACTGCCCTCATGG - Intergenic
994878187 5:105451568-105451590 CTGGGGCAGCTCTGCCCTCGTGG - Intergenic
995835819 5:116398462-116398484 CTGGTTTAGCACCTCTCTCATGG + Intronic
997411300 5:133693006-133693028 CTGTTGTAGTTCTGCCATCATGG - Intergenic
998401719 5:141852005-141852027 CTGGTGGAACAGTGGCCTCAAGG - Intergenic
999382295 5:151129923-151129945 CTGGTCTTGAACTGGCCTCAAGG + Intronic
1004565321 6:16790475-16790497 ATGGTTTAGCTCTGCCCTCTTGG - Intergenic
1005619672 6:27608265-27608287 TTGGTGTATCACTTCCATCATGG - Intergenic
1006309856 6:33249903-33249925 CTGGTCTAGCCCTGCCCCAACGG + Intergenic
1007214544 6:40227277-40227299 CTTGGGCAGCCCTGCCCTCATGG + Intergenic
1008880004 6:56372074-56372096 CTGGTGTAGGACACACCTCAAGG - Intronic
1009208994 6:60839029-60839051 ATGGTTTAGCACTGTCCTCTTGG - Intergenic
1009608429 6:65905001-65905023 CTTATGTAGCACTTCCTTCAGGG - Intergenic
1011302148 6:85887637-85887659 CAGATGAATCACTGCCCTCAAGG - Intergenic
1011450458 6:87486517-87486539 AAGGTGTAGTTCTGCCCTCATGG + Intronic
1017945113 6:159090246-159090268 CTGGTTTAGAACTGCAGTCAAGG - Intergenic
1019667986 7:2261914-2261936 CAGGGGAAGCACAGCCCTCACGG + Intronic
1023847787 7:44132498-44132520 CTGGTCTTGAACTGACCTCAAGG - Intergenic
1024489775 7:49967152-49967174 CTGGAGAAGCTCTGCCCTCTGGG - Intronic
1024676790 7:51644748-51644770 GTGGGGTAGCACTGCCATTAGGG - Intergenic
1026108825 7:67442369-67442391 CAGGAATAGCTCTGCCCTCATGG - Intergenic
1027137444 7:75635152-75635174 CTGGTTTAACCCTGCACTCAGGG - Intronic
1029213509 7:98928360-98928382 CTGGAGTAGCACTGCCCAGTTGG + Intronic
1029728576 7:102424804-102424826 CTGATCTACCACTGCTCTCACGG - Intronic
1030643759 7:112035836-112035858 CTGGTGTAGGAATGCCCTTTTGG - Intronic
1041894473 8:62907811-62907833 CTGCAGGAGCACAGCCCTCAAGG + Intronic
1045458723 8:102408278-102408300 TAGGTGTAGCACTCTCCTCAAGG - Intronic
1050627608 9:7521869-7521891 CTGGTGCAGCTCTGCTCACATGG + Intergenic
1052977252 9:34420431-34420453 CTGGTGAAGCTCTGCCCTGGGGG + Intronic
1055122171 9:72673916-72673938 ATAGAGTAGCACTGGCCTCAGGG - Intronic
1056092231 9:83216594-83216616 CTGGAGGAGCAGGGCCCTCATGG + Intergenic
1057435861 9:95040150-95040172 CTGGTGTGGCTCTGGCCTCAGGG - Intronic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic
1061638082 9:131928145-131928167 CTGATGTTGCAGTGCCCACATGG - Intronic
1186935658 X:14448276-14448298 CTGGTGTAGCCTAACCCTCAAGG - Intergenic
1188495730 X:30781165-30781187 ATGGTGTACCCCTGCCCTCGAGG - Intergenic
1189452761 X:41154385-41154407 CTGGTGGTACACAGCCCTCATGG + Intronic
1191668855 X:63730651-63730673 CTGGAGAACCACTGCCCTAATGG + Intronic
1196538897 X:116882282-116882304 TTGGTGTAGAAGTGCCCTCTGGG + Intergenic
1197563112 X:128048138-128048160 CTGCTATAGCCCTGCCATCAAGG - Intergenic
1197931310 X:131699078-131699100 CTGGGATGGCCCTGCCCTCATGG - Intergenic