ID: 987211766

View in Genome Browser
Species Human (GRCh38)
Location 5:15691119-15691141
Sequence GCCCCCAGGATGATAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987211759_987211766 -5 Left 987211759 5:15691101-15691123 CCCTTTTCCTGCCACCTGGCCCC 0: 1
1: 0
2: 3
3: 56
4: 741
Right 987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
987211754_987211766 29 Left 987211754 5:15691067-15691089 CCCTCTTAATGAGCTTTCCTATC 0: 1
1: 0
2: 1
3: 17
4: 182
Right 987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
987211757_987211766 12 Left 987211757 5:15691084-15691106 CCTATCTGTTGGTGTCACCCTTT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
987211760_987211766 -6 Left 987211760 5:15691102-15691124 CCTTTTCCTGCCACCTGGCCCCC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
987211755_987211766 28 Left 987211755 5:15691068-15691090 CCTCTTAATGAGCTTTCCTATCT 0: 1
1: 0
2: 0
3: 12
4: 157
Right 987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987211766 Original CRISPR GCCCCCAGGATGATAACCTA GGG Intronic
902996854 1:20232375-20232397 GCCCCCAGTATTTTAACATAGGG + Intergenic
907976628 1:59437047-59437069 GTCTCCAGGATGACATCCTAGGG - Intronic
909050635 1:70763650-70763672 GCCCACATGATGATAAGCCAGGG - Intergenic
915101726 1:153505910-153505932 GCCCCCAGGCTGACATCCTCTGG - Intergenic
919731268 1:200915038-200915060 GGCCCTAGGATGAGAACCCAGGG - Intronic
1067273901 10:44818016-44818038 GCCCGCAGGATGAAACCCTGAGG - Intergenic
1073426914 10:103460438-103460460 GCCCCCAGGCTGGTAGCCTCCGG + Intergenic
1078422556 11:11224320-11224342 GCCCCCAGGATGTCAGCCCAGGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079980810 11:27149837-27149859 GCCCCCAGAATGATAAAGCATGG - Intergenic
1080638480 11:34143851-34143873 GCCCTCAGGATGACAGCATAAGG + Intronic
1084447549 11:69212554-69212576 GTCACCAGGATGCTAAGCTAAGG - Intergenic
1088711570 11:112513300-112513322 GCCCCCAGTATGACAACATGGGG - Intergenic
1092260577 12:6951504-6951526 GCCCCCAGGATGGTGAGGTAAGG + Exonic
1098995191 12:77111015-77111037 ACTTCCAGGATGAGAACCTAGGG - Intergenic
1100165293 12:91910735-91910757 GCCCCCAGCATAATTAGCTATGG + Intergenic
1106927856 13:34631921-34631943 GGCCCCAGGTGGAGAACCTAAGG - Intergenic
1119958295 14:78824616-78824638 GCCCTCATTATGATAATCTATGG - Intronic
1122245844 14:100402932-100402954 ACCCTCAGGAGGACAACCTAAGG - Intronic
1123496092 15:20828398-20828420 GCAGCCAGGATTACAACCTAGGG - Intergenic
1123553326 15:21401964-21401986 GCAGCCAGGATTACAACCTAGGG - Intergenic
1123589571 15:21839352-21839374 GCAGCCAGGATTACAACCTAGGG - Intergenic
1124929080 15:34101587-34101609 GCCCTCAGGATGCTCACTTAAGG + Exonic
1125370890 15:38975190-38975212 GCCCCTAGGATGAAAACATATGG - Intergenic
1125551740 15:40550131-40550153 GCAGCCAGGCAGATAACCTAAGG - Intronic
1132427096 15:101726834-101726856 GACACCAGCATGATATCCTATGG - Intergenic
1202961674 15_KI270727v1_random:129184-129206 GCAGCCAGGATTACAACCTAGGG - Intergenic
1140066467 16:71615606-71615628 GCTCCCAGGAAGATATCCTCAGG + Intergenic
1141983492 16:87564766-87564788 GCCACCAGGCTGACAACCTGGGG + Intergenic
1142803718 17:2360824-2360846 GCCACCAGGATGAGGACCCAGGG - Intronic
1144190368 17:12840391-12840413 GTACCCAGGATGCTGACCTAGGG + Intronic
1150469074 17:65420780-65420802 CCCCTCATGATGTTAACCTAAGG + Intergenic
1153473088 18:5468383-5468405 GCCCCCTGAGTGATAACTTACGG + Intronic
1154454012 18:14504081-14504103 GCAGCCAGGATTACAACCTAGGG - Intergenic
1164574973 19:29400695-29400717 GCCCCCAGGGGGACAGCCTAAGG - Intergenic
1165706939 19:37982929-37982951 GACCCCAGGAAGACAACCCAGGG - Intronic
1165888835 19:39098792-39098814 GACCCCAGGATGAAAACGGAAGG + Intronic
1166377015 19:42333435-42333457 GCCCCCAGTCTCATAACCTAGGG - Intronic
1167510954 19:49895164-49895186 GCCTCCAGGATGGTGACCTGAGG + Exonic
927109386 2:19853373-19853395 GCCCCCAGGATTCTGAGCTAGGG + Intergenic
937322835 2:120971272-120971294 GCTCCCAGGATCAGAGCCTATGG - Intronic
937643503 2:124240045-124240067 GCACCCAGGATTAAAACATAGGG - Intronic
938164808 2:129017344-129017366 ACACCCAGGATGATGACCTCAGG + Intergenic
946400539 2:219466219-219466241 GCCCCCAGGGGGATAGCCCATGG + Intronic
948387696 2:237591760-237591782 GCCCCCAGGCTGGTAACCAAAGG + Intronic
1168902877 20:1379891-1379913 TCCCCCAGGCTGACAACTTAGGG - Intronic
1176820161 21:13649215-13649237 GCAGCCAGGATTACAACCTAGGG + Intergenic
1177846013 21:26287977-26287999 GGGCCCAGGATGAGGACCTATGG - Intergenic
1182999754 22:34845534-34845556 ACCCCCAGGGTAATAACATAGGG - Intergenic
1183043257 22:35199374-35199396 GCCCACAGGATTATAGTCTAGGG - Intergenic
954614989 3:51964862-51964884 GACCCCAGGATGCTCACCTGAGG - Intronic
959951345 3:112184046-112184068 GGCCCTAGGATGAGAACCCAGGG + Intronic
963139756 3:141937656-141937678 GCTCCCTGGCTGATAACATAGGG + Intergenic
964641584 3:158914736-158914758 GCCACCAGGATCCTAACCTAAGG - Intergenic
970132947 4:12891116-12891138 GCCCAGAGGATGTTAAGCTAAGG - Intergenic
971838897 4:31807027-31807049 CTCACCAGGATGATAACTTATGG - Intergenic
972333227 4:38082300-38082322 GCCACCAGGATGAGCACCTGAGG - Intronic
977591905 4:98836466-98836488 GCCCCCTGGATCCTAACCCAGGG + Intergenic
982595309 4:157375979-157376001 ATCCCCAGGGTGATAAACTAGGG - Intergenic
987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG + Intronic
988089311 5:26515351-26515373 GGGCCCAGGATGATCACCTCTGG + Intergenic
989476006 5:41873430-41873452 CTCCCCAGGATGATAACCAGGGG + Intergenic
998825778 5:146099761-146099783 GCCCCCAGGATGTTGTCTTAAGG - Intronic
1001586746 5:172838013-172838035 GCCCCCATGTTGAAAACCCAAGG + Intronic
1006970434 6:38038550-38038572 GCCCCCAGGAGGATATTCTGAGG + Intronic
1009479983 6:64144678-64144700 GGACCCAGGATGATAACATGGGG - Intronic
1016575877 6:145569367-145569389 GCCCCCAGCATGCTATCCCATGG + Intronic
1018785192 6:167102755-167102777 GCCTCCAGAATGAAAACCCAAGG - Intergenic
1019537405 7:1536468-1536490 TCCCCCTGGATGACACCCTAAGG + Intronic
1020509593 7:9036954-9036976 GCCAGCAGGATGATAACTTCTGG - Intergenic
1027631787 7:80615335-80615357 GCCCCCTGCATGATATTCTAAGG - Intronic
1039498641 8:38000078-38000100 AGCCCCAGGATGTTGACCTAAGG + Intergenic
1047455291 8:125003254-125003276 GCTCCCACGATGATAACTTCTGG - Exonic
1048869713 8:138787184-138787206 GCCCCCAGATTGATAACGTCAGG + Intronic
1057059116 9:91987502-91987524 GCCCCCAGTATGATCACCCAGGG + Intergenic
1057384525 9:94595391-94595413 GCCCCCAGGATGCCAAGCAAGGG - Intergenic
1203527199 Un_GL000213v1:100336-100358 GCAGCCAGGATTACAACCTAGGG - Intergenic
1192055356 X:67768349-67768371 GCCCCCAGGTTGAGAACCACTGG - Intergenic
1196614338 X:117750459-117750481 CCAACCAGGATGATAACCTTTGG - Intergenic
1199844451 X:151680620-151680642 GCCCCTAAGACTATAACCTATGG + Intergenic